ID: 1021010798

View in Genome Browser
Species Human (GRCh38)
Location 7:15462958-15462980
Sequence CTGGGCAAAGGGTCCTTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 213}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021010798_1021010806 25 Left 1021010798 7:15462958-15462980 CCCAGGAAGGACCCTTTGCCCAG 0: 1
1: 0
2: 2
3: 26
4: 213
Right 1021010806 7:15463006-15463028 GTTAGCTGGATGGAAACATCTGG 0: 1
1: 0
2: 0
3: 10
4: 140
1021010798_1021010804 11 Left 1021010798 7:15462958-15462980 CCCAGGAAGGACCCTTTGCCCAG 0: 1
1: 0
2: 2
3: 26
4: 213
Right 1021010804 7:15462992-15463014 AAAATGTGAATCAAGTTAGCTGG 0: 1
1: 0
2: 0
3: 25
4: 304
1021010798_1021010805 15 Left 1021010798 7:15462958-15462980 CCCAGGAAGGACCCTTTGCCCAG 0: 1
1: 0
2: 2
3: 26
4: 213
Right 1021010805 7:15462996-15463018 TGTGAATCAAGTTAGCTGGATGG 0: 1
1: 0
2: 0
3: 7
4: 105
1021010798_1021010808 27 Left 1021010798 7:15462958-15462980 CCCAGGAAGGACCCTTTGCCCAG 0: 1
1: 0
2: 2
3: 26
4: 213
Right 1021010808 7:15463008-15463030 TAGCTGGATGGAAACATCTGGGG 0: 1
1: 0
2: 1
3: 21
4: 280
1021010798_1021010807 26 Left 1021010798 7:15462958-15462980 CCCAGGAAGGACCCTTTGCCCAG 0: 1
1: 0
2: 2
3: 26
4: 213
Right 1021010807 7:15463007-15463029 TTAGCTGGATGGAAACATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021010798 Original CRISPR CTGGGCAAAGGGTCCTTCCT GGG (reversed) Intronic
900399277 1:2466417-2466439 CTGCGCCCAGGGGCCTTCCTTGG + Intronic
900992284 1:6103590-6103612 CCTGGCAAAGGGTCCTGGCTCGG - Exonic
902094394 1:13930719-13930741 CAGGCCAAAGGTTCCTACCTTGG - Intergenic
903764573 1:25725871-25725893 CGGGGCAGAAGGTCCATCCTGGG + Intronic
903780866 1:25819535-25819557 CTTTGCAAAGGGACCTGCCTGGG + Intronic
904002212 1:27345292-27345314 CTGGGCACACGGAGCTTCCTGGG - Exonic
904345308 1:29864442-29864464 CTGGGCTGAGTGTCATTCCTGGG - Intergenic
907473909 1:54692650-54692672 CTGAGCAAAGGGTCTTGCCCAGG - Intronic
910667513 1:89741074-89741096 CTGGGCAAACTGTCCTGGCTTGG + Intronic
912139096 1:106699644-106699666 CTGGGCAAAGGGACTTCCCAAGG - Intergenic
914712423 1:150226828-150226850 CTGGGTAAATGTTTCTTCCTAGG + Intronic
915717096 1:157954994-157955016 CTGGGCCAAGAGTACTTCATGGG + Intergenic
919782228 1:201228476-201228498 CTGGGCACAGCCTCCATCCTTGG - Exonic
919943440 1:202303982-202304004 CTTGGCCTTGGGTCCTTCCTGGG + Intronic
920293588 1:204941746-204941768 CTAGCCAGAGGGTCCCTCCTTGG + Intronic
921345254 1:214177041-214177063 CTGGGAAGAGGGCCCTGCCTAGG + Intergenic
922473658 1:225891265-225891287 AGGGACAAAGGGTCCTTCCCAGG - Intronic
923372530 1:233327854-233327876 CTGCCCAAAGGGTCCAGCCTCGG - Exonic
924300927 1:242637011-242637033 CTGAGCAAAAGGCGCTTCCTGGG + Intergenic
1067073973 10:43162314-43162336 GTGGGCAAAATGTCCTTCCCTGG - Intronic
1069738851 10:70674746-70674768 CAGGCCACAGGGTCCCTCCTGGG - Exonic
1071563457 10:86659873-86659895 CTGGACGATGCGTCCTTCCTAGG + Exonic
1071756272 10:88544005-88544027 CTGAGCGAGGGTTCCTTCCTAGG - Intronic
1074991635 10:118713292-118713314 GAGGGCAGGGGGTCCTTCCTGGG + Intronic
1075544747 10:123346559-123346581 AGGGCCAAAGGTTCCTTCCTTGG + Intergenic
1076812739 10:132897770-132897792 CTAGGCAAAGGGACCCTCCTCGG - Intronic
1077503054 11:2917863-2917885 CAGGGTAAAGCTTCCTTCCTTGG - Intronic
1077578956 11:3404754-3404776 CTGGGAAAGGGATCCCTCCTCGG + Intergenic
1078090425 11:8261646-8261668 CAGGGGAGAGGGTACTTCCTTGG - Intronic
1079738415 11:24026800-24026822 CTGGGCAAAGGTTTCTTGATAGG + Intergenic
1084553855 11:69864479-69864501 CAGGTCAAAGGGGCCTCCCTGGG - Intergenic
1084586736 11:70066826-70066848 CGGGGCAGAGTGTCCCTCCTGGG - Intergenic
1084836421 11:71804718-71804740 CTGGGAAAAGGATCCCTCCTAGG - Intergenic
1086665938 11:89482196-89482218 ATGGCAAAAGGGTCCTTCCCAGG - Intronic
1088593600 11:111423403-111423425 CTGGGCTAAGGGCCTGTCCTGGG - Intronic
1088759768 11:112918445-112918467 CTGGGACAAGGGCCCCTCCTGGG + Intergenic
1089296004 11:117468679-117468701 CTGGGCAGCTGGTCCTTCCTGGG - Intronic
1089587599 11:119520240-119520262 CTGGGCTATTGGTCCTTCCAGGG - Intergenic
1091327671 11:134703404-134703426 CTGAGCACAGTGTCCTTGCTGGG - Intergenic
1091656252 12:2348733-2348755 CGGGGGAAAGGTTCCTTCCTCGG + Intronic
1092406886 12:8227636-8227658 CTGGGAAAAGGATCCCTCCTAGG + Intergenic
1095366105 12:41407357-41407379 CTGAGCAAAGGGTTCTTTGTGGG + Intronic
1097173353 12:57129212-57129234 CTGGGCAAATGATGCTTCCGGGG + Intronic
1097446576 12:59679078-59679100 AGGGGCAGAGGGGCCTTCCTAGG + Intronic
1098283465 12:68884670-68884692 CTGTGCAAAGTTTCCTTACTGGG + Intronic
1101953610 12:109195122-109195144 CTGGGCCCAGGGTCCTTGTTGGG + Intronic
1102602722 12:114044648-114044670 CTACGCAAAGGGTCTTTGCTGGG - Intergenic
1103734320 12:123049515-123049537 CTGGGGAATGGGTGCTTCCTGGG - Intronic
1104384450 12:128338396-128338418 CTGGGCATGTGCTCCTTCCTTGG + Intronic
1105005347 12:132717842-132717864 CTGGGCAAAGCGGCCCTGCTGGG + Intronic
1105586979 13:21754743-21754765 TGGGGCAAATGGTCCTTCTTGGG + Intergenic
1105704521 13:22960939-22960961 GTGGGCTACGGGGCCTTCCTGGG - Intergenic
1106377711 13:29204853-29204875 CTGGCCATAGGGTCCCTCATGGG + Intronic
1106576384 13:30979233-30979255 CAGGGACAGGGGTCCTTCCTGGG + Intergenic
1107880446 13:44827680-44827702 CAGGACCAAGGGTGCTTCCTTGG + Intergenic
1111237713 13:85431032-85431054 GTGGGGAGAGGGGCCTTCCTGGG - Intergenic
1111954728 13:94743849-94743871 CTGGCCAAAGGGTCTTTGCAGGG + Intergenic
1112715115 13:102175494-102175516 CTGGGCCAAGAGTTTTTCCTAGG - Intronic
1113156624 13:107330077-107330099 CTGAGCCTAGGGTCCATCCTGGG - Intronic
1113568484 13:111336251-111336273 CTGGGCAGTGGGCCCTGCCTTGG + Intronic
1118153982 14:63220570-63220592 CTGGGCACTGGGTAGTTCCTCGG - Intronic
1118731683 14:68671158-68671180 CTGGGCAAACCATCCATCCTGGG + Intronic
1119734596 14:76973841-76973863 CTAGGCAAAGAGCCCTTCCTAGG - Intergenic
1119765785 14:77186881-77186903 CTGGACCAGGGATCCTTCCTTGG + Intronic
1121465909 14:94115528-94115550 CTGGGCAGCAGGACCTTCCTTGG - Intronic
1125770741 15:42164165-42164187 CTGAGAAAAGTCTCCTTCCTGGG - Intronic
1128343024 15:66835834-66835856 CTGGGCATAGGTTCCTAGCTGGG - Intergenic
1128723219 15:69968382-69968404 CTGGGCACACAGTCCTCCCTGGG - Intergenic
1129315489 15:74740683-74740705 CTGGTCAGAGCCTCCTTCCTTGG - Intergenic
1129656860 15:77530164-77530186 ATGGGCAGATGGGCCTTCCTGGG - Intergenic
1129708817 15:77809785-77809807 CTGGGCAAATGTTTCTTCCCTGG - Intronic
1130334037 15:82943618-82943640 CTGGGCAATGGATCCTTTTTGGG - Intronic
1131035352 15:89218468-89218490 CTGTGAAAAGGGTCCAGCCTCGG - Intronic
1133347555 16:5080846-5080868 CTGGGAAAGGGATCCCTCCTAGG + Intronic
1133400495 16:5482783-5482805 CTGGGCAAACGGCTTTTCCTGGG + Intergenic
1134439211 16:14287561-14287583 CTATGCACAGGCTCCTTCCTGGG - Intergenic
1135255493 16:20938569-20938591 CTGGGCAAGTGTTCTTTCCTTGG - Intronic
1136063247 16:27741149-27741171 ATGGGCAAAGGGACATACCTTGG - Intronic
1137256323 16:46778220-46778242 ATGGGCGGAGGGTCCTTCCTGGG - Intronic
1137717908 16:50610349-50610371 CTGGGCCCAGGGTCCCTCATGGG - Intronic
1138148870 16:54636992-54637014 CTGGACAAAGGATCTTTCTTAGG - Intergenic
1138191043 16:55014439-55014461 CTGGGTAGAGAGTCCTTCCTAGG + Intergenic
1142144473 16:88487165-88487187 CTGGGAGAAGGGGCCTCCCTGGG + Intronic
1142367196 16:89656921-89656943 CTGGGCAAGGGGTCCTGGGTCGG + Intronic
1142713390 17:1735567-1735589 CTGTGCGAAGGGTCTTCCCTGGG - Exonic
1144821283 17:18076494-18076516 CTGGGCAAGGGGCCCTTGCATGG - Intergenic
1146502151 17:33373353-33373375 CTGGGCATAGGCCCATTCCTGGG + Intronic
1146791100 17:35751044-35751066 CTGGGGAAAGGGTCAGGCCTGGG - Intronic
1150640684 17:66947573-66947595 CTGGGCAGAGAGCCCTTCCCTGG - Intergenic
1151939362 17:77282904-77282926 AAGGGCAAAGGGCCCTCCCTGGG - Intronic
1151956218 17:77381437-77381459 CGGGGCCAAGGGTCCCTGCTTGG - Intronic
1152566029 17:81100828-81100850 CTGGTCACAGGGTCCTCCCCTGG + Intronic
1153576365 18:6525679-6525701 CTGGGCAAAGGCTTCCTCCATGG - Intronic
1155147855 18:23098689-23098711 CAGGCCAGAGGGTCCATCCTGGG + Intergenic
1156455683 18:37292410-37292432 CAGGGCAAGGAGACCTTCCTGGG + Intronic
1156558533 18:38094724-38094746 CTGGCCAAAGTGATCTTCCTTGG - Intergenic
1157947039 18:51991952-51991974 CTGAGCCAAGGTTCCTTCCATGG + Intergenic
1160155772 18:76432768-76432790 CTGGGCATGGGGTCCTGCCTGGG - Intronic
1161099949 19:2416566-2416588 CTGGGCACTGCGTCCCTCCTGGG + Exonic
1161242079 19:3228303-3228325 CTGGGGTGGGGGTCCTTCCTGGG - Intronic
1161403352 19:4078546-4078568 CTGGGCCAAGGGTCTCTCCCTGG - Intergenic
1162369325 19:10269666-10269688 CTGCGCCACGGGTTCTTCCTCGG - Intergenic
1163491661 19:17620473-17620495 CAGGGCTCAGGGGCCTTCCTGGG + Intronic
1164740335 19:30571176-30571198 CTGACAAAAGGGTCATTCCTGGG + Intronic
1166087685 19:40487867-40487889 CTGGGGCAGGGGTCCTCCCTGGG + Intronic
1167328766 19:48841178-48841200 CTGGGGACAGTGTCCTTCCCAGG + Exonic
1167982349 19:53285307-53285329 CTGGGCAAAGGGCCCTTCAATGG + Intergenic
1167983795 19:53298674-53298696 CTGGGCAAAGGGCCCTTTGATGG - Intergenic
1168630310 19:57950865-57950887 GTGGGAAAAGGGTGCTTCCCAGG + Intergenic
926125049 2:10266924-10266946 GTGGGAGAAGGGTCTTTCCTGGG + Intergenic
927051369 2:19332746-19332768 CTGGAAAAAGTGTGCTTCCTAGG + Intergenic
927484949 2:23482120-23482142 CTGGGGAAAGAGTCCATCCCTGG - Intronic
927918132 2:26949572-26949594 CTGGGCAGAGCATCCTTGCTTGG + Exonic
928591769 2:32824028-32824050 CTGTGCTAAGGCTCCATCCTAGG - Intergenic
928729535 2:34215338-34215360 GTGGGGAAATGGGCCTTCCTGGG + Intergenic
929597827 2:43187193-43187215 CTGGCCAAAGGGTCCGGCCCTGG - Intergenic
929933851 2:46278877-46278899 CTTGGCATAGGAACCTTCCTTGG + Intergenic
933510614 2:83236719-83236741 CTGGTCAATGATTCCTTCCTTGG + Intergenic
936022375 2:109004619-109004641 TGGAGCAAAGGGTCTTTCCTGGG + Intergenic
936269912 2:111041642-111041664 ATGGCCAAAGGCTGCTTCCTGGG - Intronic
937285943 2:120751160-120751182 TTGGGCAAGGGATCCTTCCGGGG - Intronic
938494384 2:131785624-131785646 CTGGGCATAGGCTTCTTCCTGGG + Intergenic
940396370 2:153196518-153196540 GGGGGCAAAGGGCCCTTCCTGGG + Intergenic
944543601 2:200777831-200777853 CTGGGCAGATGCCCCTTCCTGGG + Intergenic
944690520 2:202154443-202154465 GTGGAAAAAGGGACCTTCCTAGG - Intronic
945207857 2:207351341-207351363 CTGAGCAAACAGGCCTTCCTAGG - Intergenic
946213083 2:218163103-218163125 GTGGACAAAGGGATCTTCCTTGG + Exonic
946225490 2:218262061-218262083 CTAGCAACAGGGTCCTTCCTGGG - Exonic
946305630 2:218855604-218855626 ATGGGCAAAGGGTCCTGGCCTGG - Intergenic
947632991 2:231665758-231665780 CTGGGCAAGGGGTCCGTGCCTGG + Intergenic
947928528 2:233942516-233942538 CTGGGCAAAGTTTCCATTCTGGG - Intronic
947983099 2:234426576-234426598 CTGAGCCAAGGATCCTTTCTTGG - Intergenic
948931794 2:241136862-241136884 CTGGACCCAAGGTCCTTCCTGGG + Intronic
949026818 2:241770244-241770266 CTGGGCACATGGTCCGTGCTGGG + Intergenic
1168842883 20:921058-921080 CTGGGGAGAGGGTCACTCCTGGG + Intergenic
1170508717 20:17055188-17055210 CTGGGCAGGGGGTGTTTCCTTGG + Intergenic
1172180846 20:33002522-33002544 CTGGGGAGAGGGTCCAGCCTCGG - Intronic
1173034234 20:39393577-39393599 CTGGGCCAAGGGGCTTTCTTTGG - Intergenic
1173819089 20:46009256-46009278 ATGGGCAATGGGGCTTTCCTAGG + Intronic
1173859547 20:46273880-46273902 CTGGGCCCTGGGGCCTTCCTTGG - Intronic
1174035899 20:47668078-47668100 CTTGGCACAGGGACCATCCTCGG - Intronic
1174038509 20:47682948-47682970 CTGGGCCCAGGGGCCTCCCTGGG + Intronic
1174399429 20:50267944-50267966 CTGGGTCAAGGGTCCTTCCTGGG + Intergenic
1175285355 20:57833780-57833802 CTGGGAAAAGGGGCCCTCATGGG + Intergenic
1175285537 20:57834369-57834391 CTGGGAAAAGGGGCCCTCATGGG + Intergenic
1175795073 20:61766072-61766094 GTGGGCCCAGGCTCCTTCCTGGG - Intronic
1177165216 21:17594283-17594305 CTGGGCAAAGGGTGCCACATTGG + Exonic
1178175836 21:30097307-30097329 CTGTGCACATGGCCCTTCCTTGG + Intergenic
1178618530 21:34154348-34154370 CCCCGCAAAGGGACCTTCCTTGG + Intergenic
1182299437 22:29329513-29329535 GTGTGCACAGAGTCCTTCCTAGG - Intronic
1182571409 22:31241599-31241621 ATGGCCACAGGGTCCTTCCTGGG - Intronic
1182623416 22:31630131-31630153 CGGGGAAAATGGTCCTCCCTGGG + Intronic
1182795069 22:32985927-32985949 CTGGGCTGAGCGTCCTCCCTTGG + Intronic
1184713609 22:46267987-46268009 CTGGGCACCCGGGCCTTCCTGGG - Exonic
952581321 3:34836932-34836954 CTGGGCCAATGGGACTTCCTAGG - Intergenic
953788364 3:45928341-45928363 CTGGGCAGAGGATCCGTCTTTGG - Intronic
953856839 3:46505751-46505773 CTGTGCAGAGGCTCCTCCCTGGG - Intergenic
954071020 3:48142861-48142883 CTGGGCAGAGGGCACCTCCTGGG - Intergenic
954544169 3:51418659-51418681 CAGGGTAAGGGTTCCTTCCTAGG - Exonic
955860556 3:63325495-63325517 CTGGGCTTAGGATCTTTCCTGGG - Intronic
957136373 3:76294191-76294213 CAGGGCAAAGGGGGTTTCCTGGG + Intronic
961885552 3:130094303-130094325 CTGGGAAAAGGATCCCTCCTAGG + Intronic
962175626 3:133151129-133151151 CTGGGTAAGGGGACCTTGCTAGG + Intronic
963290010 3:143477908-143477930 CTAGGCAAAGGGTCAATCCCAGG + Intronic
965673204 3:171168375-171168397 CCGGGCAAAGGCTCAGTCCTGGG - Intronic
966883407 3:184362040-184362062 CGGGGCAGAGGGGCCTTCCCAGG - Intronic
966923316 3:184628653-184628675 CTGAGAAGAGGGTCCTTCCCAGG - Intronic
967720134 3:192807492-192807514 CTGGGCAAAGGGTCAGTGATGGG - Intronic
968209627 3:196837997-196838019 CTGAGCAAATAGTCCTTCATGGG + Intergenic
968438951 4:611948-611970 CTGGGGGAAGGCTCCTTCCTGGG + Intergenic
968994744 4:3938446-3938468 CTGGGAAAAGGATCCCTCCTAGG + Intergenic
969308548 4:6339255-6339277 TTGGGCCAGGGGTCCTGCCTTGG + Intronic
969511663 4:7621219-7621241 AGGGGCACAGGGTCTTTCCTGGG + Intronic
969590292 4:8118165-8118187 CTGGGCTCAGGGTCCAGCCTCGG - Intronic
969819218 4:9707827-9707849 CTGGGAAAGGGATCCCTCCTAGG - Intergenic
969885246 4:10209453-10209475 ATGGGGAAGGGGACCTTCCTTGG + Intergenic
970566647 4:17338192-17338214 CTGGGGAAATGGTCTTTCTTTGG + Intergenic
974278529 4:59759411-59759433 GAGGGCAAAGAGACCTTCCTGGG + Intergenic
975378547 4:73672167-73672189 CAGGGAAAAGAGTCCTTCCCAGG + Intergenic
977084533 4:92576528-92576550 CAAGGCAGAAGGTCCTTCCTAGG - Intronic
979725108 4:123951876-123951898 CTTGGAAAATGTTCCTTCCTGGG + Intergenic
984734465 4:183097952-183097974 CTGGGCTTCGGGGCCTTCCTCGG + Intergenic
989723731 5:44561466-44561488 CTTGGAAGAGGGTCCTTCTTGGG + Intergenic
990523933 5:56606411-56606433 TTTGGCCAAGGGTCATTCCTTGG + Intergenic
996706988 5:126507539-126507561 ATGAGCGAAGGGTCTTTCCTAGG + Intergenic
997607235 5:135183936-135183958 CTGGGGACAGGGTCCTTGCCAGG - Intronic
998335061 5:141364445-141364467 CTGGACAAAGGCTCCTTCGTCGG + Exonic
998336150 5:141374198-141374220 CTGGAGAAAGGCTCCTTCGTAGG + Exonic
1003950058 6:11108572-11108594 TTGGGCAAAGGGATCTCCCTGGG + Intronic
1005976667 6:30805335-30805357 ATGGGCAAAGATTCCTGCCTTGG + Intergenic
1005978804 6:30820245-30820267 CTGGGCAACAAGTCCTTCCTTGG - Intergenic
1006573639 6:35026604-35026626 CTCCTCAAAGGGGCCTTCCTTGG - Intronic
1007122466 6:39394620-39394642 CAGGGCAACAGGTCCTTCCATGG + Intronic
1009614893 6:65991275-65991297 GTGGGCAAAGGTTCCATCCTTGG - Intergenic
1012357925 6:98339346-98339368 CTGGGCACAGAGTCCTTGGTAGG + Intergenic
1017522443 6:155213954-155213976 GGGGGCAATGGGTCCTTCCTAGG + Intronic
1019660799 7:2222980-2223002 CTGTGCCAAGTGCCCTTCCTGGG - Intronic
1021010798 7:15462958-15462980 CTGGGCAAAGGGTCCTTCCTGGG - Intronic
1022525871 7:31036966-31036988 CTGGGCAGGGGCTCCTTCCCAGG + Intergenic
1024139075 7:46443476-46443498 GTGGGCAAATGGTCCTTACAGGG + Intergenic
1024597562 7:50952959-50952981 CTTGGCAATGCGTCCTTTCTTGG + Intergenic
1025117630 7:56272025-56272047 AGGGGCAAAGGGTCATTCTTTGG + Intergenic
1025605570 7:63037927-63037949 CTGGACTAAGCGTCCATCCTAGG - Intergenic
1027779957 7:82508118-82508140 CGGGGACAGGGGTCCTTCCTGGG + Intergenic
1027780018 7:82508368-82508390 GGGGGCAAGGGGGCCTTCCTGGG + Intergenic
1031543785 7:123027788-123027810 CTGGGAAAGGAGTCCATCCTAGG - Intergenic
1031786473 7:126040496-126040518 AAGGGCAGAGGGGCCTTCCTAGG - Intergenic
1032019873 7:128401382-128401404 CTGGGGAAAGCCTCTTTCCTGGG + Intronic
1032841706 7:135719227-135719249 CTGGACAAAGGGGCGTCCCTCGG + Intronic
1033720139 7:144050516-144050538 CTGGGAAATGGGGCCATCCTGGG + Exonic
1033737080 7:144232707-144232729 CTGGGGAACGGGGCCATCCTGGG - Exonic
1033738786 7:144251467-144251489 CTGGGGAATGGGACCATCCTGGG - Intergenic
1033744261 7:144299487-144299509 CTGGGGAATGGGACCATCCTGGG + Intergenic
1033745977 7:144318239-144318261 CTGGGGAACGGGGCCATCCTGGG + Exonic
1034707928 7:153163126-153163148 CTGGGCAGGAGGTCCTTCTTTGG - Intergenic
1036381398 8:8238378-8238400 CTGGGAAAAGGATCCCTCCTAGG - Intergenic
1036847261 8:12178614-12178636 CTGGGGAAAGGATCCCTCCTAGG + Intergenic
1036868626 8:12420935-12420957 CTGGGGAAAGGATCCCTCCTAGG + Intergenic
1038243533 8:25832396-25832418 CTGGGGAAAGCATCCTTCCCAGG + Intergenic
1039255713 8:35716963-35716985 CTGTGCTGAGGGTGCTTCCTGGG + Intronic
1039471232 8:37814924-37814946 CTCCGCAATGGCTCCTTCCTGGG + Exonic
1039480910 8:37872612-37872634 AAGGGCAAACGGTACTTCCTGGG + Exonic
1040453505 8:47572889-47572911 CTGGGCTTAGGGAGCTTCCTTGG - Intronic
1042705753 8:71664425-71664447 CTGGGCAAAGGCTCCTTCTTTGG - Intergenic
1042862476 8:73328306-73328328 CTGGGCTCAGGTTCCTCCCTAGG - Intergenic
1044729892 8:95221224-95221246 CTGGGCAAAGGCTCCTACTTAGG + Intergenic
1045226327 8:100249628-100249650 ATGGGTAAAGGGTTCTTTCTGGG + Intronic
1046289433 8:112137538-112137560 CTAGGAGAGGGGTCCTTCCTTGG - Intergenic
1046915748 8:119676436-119676458 CTGCTCAAAGAGTTCTTCCTAGG + Intergenic
1047224927 8:122948095-122948117 CTGGGGAAAGGGCCATTCCCCGG - Intronic
1047294720 8:123560610-123560632 CTGTGGAAAGGGGCCTTCCCAGG - Intergenic
1048165684 8:132059417-132059439 CATGGCTAAGGGTCTTTCCTTGG - Intronic
1049035390 8:140071546-140071568 CTGGACAAAGGGGCCTTCCCTGG + Intronic
1052641141 9:31166811-31166833 AGGGGAAGAGGGTCCTTCCTGGG + Intergenic
1053293212 9:36895807-36895829 CTGGGCAAAAAGCCCCTCCTGGG + Intronic
1057386827 9:94612301-94612323 CTGGGAAAAGGGGCCTTTATTGG - Intronic
1060771509 9:126335474-126335496 CTGGCCACAGGTTCCCTCCTTGG + Intronic
1062342783 9:136101102-136101124 CTGGGCAAAGGGCACTTCTATGG + Intergenic
1203689501 Un_GL000214v1:29338-29360 CTAGGCAAAGAGTTCTGCCTAGG - Intergenic
1203646774 Un_KI270751v1:74715-74737 CTAGGCAAAGAGTTCTGCCTAGG + Intergenic
1187415235 X:19087416-19087438 CTGGGTTAGGTGTCCTTCCTCGG - Intronic
1196238316 X:113308781-113308803 ATGGGCAAAGTGACCTGCCTAGG - Intergenic