ID: 1021011411

View in Genome Browser
Species Human (GRCh38)
Location 7:15472735-15472757
Sequence TAGTGGTATTGCCAGTGTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 180}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021011411 Original CRISPR TAGTGGTATTGCCAGTGTAT AGG (reversed) Intronic
900957273 1:5893830-5893852 TAGAGGTAATGCCAGCGTCTGGG - Intronic
901834184 1:11913041-11913063 AAGTGGTAATGCCAGTGCCTGGG - Intergenic
902303588 1:15520609-15520631 AAGCGGTAATGCCAGTGTCTGGG + Intronic
902938464 1:19782045-19782067 GAGTGGAATTGCCAGAGCATAGG - Intronic
905708960 1:40084892-40084914 TAGCGGTAATGCCAGCGTCTGGG + Intronic
907294948 1:53444822-53444844 TAGTGGTAGCGCCAGTGCCTGGG + Intergenic
909307849 1:74104198-74104220 TTTTGGTATTGTCAGTGTTTTGG - Intronic
909455247 1:75842704-75842726 TAGTGGTAATGCCAGCGTCTGGG + Intronic
914378884 1:147098526-147098548 TAGTGGTAATGCCAGCATCTGGG - Intergenic
915481876 1:156192479-156192501 TAGCGGTAATGCCAGCGTCTGGG + Intergenic
916098698 1:161374592-161374614 TTGTGGTATTGTCAGTGGAAAGG - Exonic
916487719 1:165274216-165274238 TAGAGGTATTGGCAATGGATGGG - Intronic
917096704 1:171405258-171405280 TAGTGGTAATGCCAGTGCCTTGG - Intergenic
920130298 1:203726959-203726981 TGGTGATATTGCCTATGTATAGG - Intronic
1065211642 10:23409581-23409603 CAGTGGTATTGCCTGTATACCGG + Intergenic
1065899278 10:30190682-30190704 TAGCGGTAGTGCCAGTGCCTGGG + Intergenic
1069078832 10:64066338-64066360 AAGTGGTAATGCCAGTGTCTGGG - Intergenic
1070586930 10:77773433-77773455 AAGTGGTAACGCCAGTGTCTGGG - Intergenic
1072012619 10:91316489-91316511 TATTGTTATTTCCACTGTATTGG - Intergenic
1072068556 10:91894276-91894298 AAGTGGTAATGCCAGTGTCTGGG + Intergenic
1076419598 10:130321564-130321586 TAGTGGTAATGCCAGCGTCTGGG + Intergenic
1076912267 10:133396862-133396884 TAGCGGTAACGCCAGTGTCTGGG + Intronic
1077520056 11:3027765-3027787 TAGTGGTAACGCCAGCGTCTGGG + Intronic
1077706684 11:4493399-4493421 TAGCGGTAATGCCAGTGCCTGGG - Intergenic
1078004792 11:7524505-7524527 TAGTGTTATTCCCATTTTATGGG + Intronic
1080070873 11:28085207-28085229 AAGTGGTAATGCCAGTGTCTGGG + Intronic
1082580034 11:54855258-54855280 TAGTAGTAATGCCAGTGTCTGGG + Intergenic
1082689012 11:56277426-56277448 TAGCGGTAATGCCAGCGTCTGGG + Intergenic
1083130320 11:60618869-60618891 TAGTGGTAATGCCAGTGCCTGGG - Intergenic
1083280236 11:61622329-61622351 TTGTGGTGTTCCCAGGGTATGGG - Intergenic
1084311781 11:68321096-68321118 TAGGGGTCTGGCCAGTGAATAGG + Intronic
1088600917 11:111474157-111474179 TAAAGTTATTGCCAGTGTCTGGG + Intronic
1091809450 12:3383460-3383482 TAGTGGTATCCCCAGTGTGGTGG + Intronic
1092160146 12:6311279-6311301 TGGTGGTATTCCCAGAGTCTGGG + Intronic
1093400496 12:18740569-18740591 TAGTGGTAGGGTGAGTGTATAGG - Intergenic
1095726563 12:45460189-45460211 GAGTGGACTTGCCAGTGAATTGG + Intergenic
1096760516 12:53838075-53838097 TAGTGGGATTTCCAGGTTATGGG + Intergenic
1101776541 12:107799626-107799648 TAGTGGTAATGCCAGCGTCTGGG - Intergenic
1102832361 12:116015397-116015419 TAGTGTTATTGCCAGGGGATAGG - Intronic
1106297261 13:28426818-28426840 TAGTGGTATTGCCAAAGTCTAGG + Intronic
1107694352 13:42986003-42986025 AAGTGCCATTGTCAGTGTATGGG + Intronic
1108544171 13:51474232-51474254 TTCTGGTATTGCCATTGTAGTGG - Intergenic
1111108512 13:83676043-83676065 AAGCGGTAATGCCAGTGTCTGGG - Intergenic
1112586087 13:100720190-100720212 TATTTGTATTGCCAATGTACAGG - Intergenic
1114902271 14:27077993-27078015 TACTGGCATTCCCAGTGTACAGG - Intergenic
1114985343 14:28220254-28220276 CAGTTGTACTGCCATTGTATAGG + Intergenic
1116674361 14:47886791-47886813 GAGTGGTCTTTCCTGTGTATGGG + Intergenic
1119049500 14:71352722-71352744 AAGTGGAATTGCCAGGTTATAGG + Intronic
1121631879 14:95427201-95427223 TAGGGGTAACGCCAGTGTCTGGG + Intronic
1202893471 14_KI270722v1_random:181982-182004 TAGTGGTAATGCCAGCGTCTGGG + Intergenic
1124216963 15:27815574-27815596 AAGTGGAATTGCTAGTGTAGGGG - Intronic
1124352068 15:28963209-28963231 ACGTGGTATTTTCAGTGTATAGG + Intronic
1124951078 15:34321588-34321610 GAGTGGAATTGCCAGATTATAGG - Intronic
1129468051 15:75734943-75734965 AAGTGGTAACGCCAGTGTCTGGG + Intergenic
1129574860 15:76732526-76732548 TAGTGGTAACGCCAGCGTCTGGG + Intronic
1129921157 15:79320154-79320176 TAGCGGTAATGCCAGTGTCTGGG - Intronic
1133300124 16:4777363-4777385 CAGTGGTAATCCCAGTGTTTTGG + Intergenic
1136710398 16:32232239-32232261 AAGTGGTAATGCCAGTGTCTGGG - Intergenic
1136757514 16:32697172-32697194 AAGTGGTAATGCCAGTGTCTGGG + Intergenic
1136810592 16:33173203-33173225 AAGTGGTAATGCCAGTGTCTGGG - Intergenic
1136817068 16:33283283-33283305 AAGTGGTAATGCCAGTGTCTGGG - Intronic
1137831273 16:51545652-51545674 TAGTGGCTTTGCTATTGTATAGG - Intergenic
1138878633 16:60982925-60982947 AAGTGTTATTGCCAATATATAGG - Intergenic
1139164941 16:64554930-64554952 TAGGGATAGTGCCAGTTTATAGG - Intergenic
1203059662 16_KI270728v1_random:957521-957543 AAGTGGTAATGCCAGTGTCTGGG + Intergenic
1144144861 17:12387703-12387725 TAGAGGTAGTGCCAGTGCAGAGG + Intergenic
1146103783 17:30012105-30012127 TAGTGGTAACGCCAGCGTCTGGG + Intronic
1146535323 17:33645829-33645851 TAGTGGAAATGCCAATGAATTGG + Intronic
1147819418 17:43232811-43232833 TAGCGGTAATGCCAGTGCCTGGG + Intergenic
1147820007 17:43235841-43235863 TAGCGGTAATGCCAGTGCCTGGG + Intergenic
1147821321 17:43243240-43243262 TAGCGGTAATGCCAGTGCCTGGG + Intergenic
1147822120 17:43247726-43247748 TAGCGGTAATGCCAGTGCCTGGG + Intergenic
1147823042 17:43253169-43253191 TAGCGGTAATGCCAGTGCCTGGG + Intergenic
1147823813 17:43257770-43257792 TAGCGGTAATGCCAGTGCCTGGG + Intergenic
1147824576 17:43262212-43262234 TAGCGGTAATGCCAGTGCCTGGG + Intergenic
1147825728 17:43268688-43268710 TAGCGGTAATGCCAGTGCCTGGG + Intergenic
1147826859 17:43275155-43275177 TAGCGGTAATGCCAGTGCCTGGG + Intergenic
1147827747 17:43280033-43280055 TAGCGGTAATGCCAGTGCCTGGG + Intergenic
1147828855 17:43286194-43286216 TAGCGGTAATGCCAGTGCCTGGG + Intergenic
1147829950 17:43292337-43292359 TAGCGGTAATGCCAGTGCCTGGG + Intergenic
1147831692 17:43301821-43301843 TAGCGGTAATGCCAGTGCCTGGG + Intergenic
1147835022 17:43323802-43323824 TAGCGGTAATGCCAGTGCCTGGG - Intergenic
1147836279 17:43334295-43334317 TAGTGGTAGCGCCAGTGCCTGGG - Intergenic
1147838366 17:43351434-43351456 TAGTGGTAGTGCCAGTGCCTGGG - Intergenic
1151149898 17:72076146-72076168 GAGTGCTAATGCCAGGGTATCGG + Intergenic
1155011652 18:21784758-21784780 TAGTGGTAACGCCAGTGCCTGGG + Intronic
1156878614 18:42047824-42047846 TAGTGATACTGCCAGTCTGTGGG + Intronic
1159176823 18:64847379-64847401 ATTTGGTATTGCCAGTGTTTTGG - Intergenic
1162290431 19:9776082-9776104 TAGCGGTAATGCCAGCGTCTGGG + Intronic
1165046200 19:33107007-33107029 TAGTGGTATTTCCACAGTTTGGG - Intronic
1165671264 19:37681197-37681219 TAGCGGTAACGCCAGTGTCTGGG - Intronic
1165852813 19:38860138-38860160 AAGCGGTAATGCCAGTGTCTGGG - Intergenic
1166437151 19:42777171-42777193 TAGCGGTAATGCCAGCGTCTGGG - Intronic
1166483330 19:43191856-43191878 TAGTGGTAATACCAGCGTCTGGG - Intronic
1166485798 19:43210943-43210965 TAGTGGTAACGCCAGCGTCTGGG - Intergenic
1166492957 19:43274895-43274917 TAGTGGTAACGCCAGGGTCTGGG - Intergenic
1168058615 19:53877927-53877949 AAGTGGTAACGCCAGTGTCTGGG - Intergenic
1168480957 19:56719194-56719216 TAGTGGTAATGCCAGTGTCTGGG - Intergenic
927895555 2:26779466-26779488 GAGGGGTATTTCCAGTGGATGGG - Exonic
927959424 2:27231591-27231613 TAGGGGTATTGCCAGGGGAGGGG - Intronic
931521369 2:63100738-63100760 TAGTGGGATTGCCAGATCATAGG + Intergenic
932342850 2:70977520-70977542 TAGCGGTAATGCCAGCGTCTGGG - Intronic
932672950 2:73754074-73754096 TAGTGGTAATGCCAGCGTCTGGG + Intergenic
934030312 2:88039287-88039309 TAATATTAATGCCAGTGTATGGG + Intronic
934165149 2:89287487-89287509 TAGTTGTATTGGCAGTATGTAGG + Intergenic
934202124 2:89894975-89894997 TAGTTGTATTGGCAGTATGTAGG - Intergenic
936800639 2:116260972-116260994 TACTGGTATATCCAGTGCATTGG + Intergenic
942585774 2:177475241-177475263 TAGTGATATTGTCAGTATAGTGG + Intronic
942596310 2:177594593-177594615 TAGCGGTAACGCCAGTGTCTGGG - Intergenic
945863779 2:215154057-215154079 TTTTGGTGTTGCCAGTGTTTTGG + Intergenic
946240876 2:218354897-218354919 AAGCGGTAGTGCCAGTGTTTGGG + Intergenic
946561774 2:220921984-220922006 TAGTGGGAATGCCACTGGATGGG + Intergenic
947606636 2:231490195-231490217 TAGCGGTAACGCCAGTGTCTGGG - Intergenic
1169295552 20:4394265-4394287 TAGCGGTAATGCCAGCGTCTGGG - Intergenic
1169596068 20:7200552-7200574 TAGGGGTTTTGCCAGTGTCCTGG - Intergenic
1171953888 20:31444436-31444458 TAGTTTTATCTCCAGTGTATAGG + Intronic
1177611360 21:23452933-23452955 TAGCGGTAATGCCAGTGCCTGGG - Intergenic
1180200944 21:46223818-46223840 TAGTGGTAACGCCAGCGTCTGGG + Intronic
1181809782 22:25396448-25396470 TAGGGGTCTGGCCAGTGAATAGG - Intronic
1182064971 22:27424426-27424448 CTGTTGTATTGCCAGTGTCTGGG - Intergenic
1184133641 22:42533087-42533109 TAGCGGTAATGCCAGCGTCTGGG + Intergenic
1184136340 22:42552179-42552201 TAGCGGTAATGCCAGCGTCTGGG - Intergenic
1184221660 22:43104540-43104562 TAGTGGTAGCGCCAGTGCCTGGG - Intergenic
950332688 3:12169028-12169050 TGGTGGTATTTCCAGGATATTGG + Intronic
953171805 3:40513936-40513958 TAGCGGTAATGCCAGTGCCTGGG + Intronic
953294119 3:41695995-41696017 TAGCGGTAACGCCAGTGTCTGGG + Intronic
953900168 3:46835667-46835689 TAGTGGTAGCGCCAGTGCCTGGG - Intergenic
954102252 3:48382882-48382904 TAGTGGTGTTGGCAGTGCAAAGG - Intronic
954971392 3:54654367-54654389 TGGTTGTATTCCCAGTGAATTGG + Intronic
962299419 3:134224649-134224671 TAGTGGTAGCGCCAGTGCCTGGG - Intronic
963326985 3:143874105-143874127 AAGCGGTAATGCCAGTGTCTGGG - Intergenic
963754016 3:149214408-149214430 AATTGGTATTCCCAGTGTATTGG - Intronic
965029602 3:163348086-163348108 TTGTGGTATTACCAGTATTTTGG - Intergenic
966815531 3:183886872-183886894 TAGGGGTAATGCCAGCGTCTGGG + Intergenic
966965504 3:184987888-184987910 ATGTGGTATTGTCAGTGTTTTGG + Intronic
967600723 3:191385181-191385203 TAATGGAATTGCCAGGGTAATGG + Intronic
967795157 3:193592038-193592060 TGGTGGTATTGTGAGTGCATGGG + Intronic
968846787 4:3047584-3047606 TAGTGGTAATGACAGTGCCTGGG + Intergenic
970514561 4:16815308-16815330 TAGTGACATTGTCAGGGTATGGG + Intronic
970530550 4:16977934-16977956 AAATGGAATTGCCAGTGTAATGG + Intergenic
971259336 4:25042236-25042258 TATTAGTATTCCCAATGTATAGG + Intergenic
973234258 4:47881360-47881382 ATGTGGTATTGTCAGTGTTTTGG - Intronic
973960944 4:56109079-56109101 AAGCGGTAATGCCAGTGTCTGGG - Intergenic
974170094 4:58255275-58255297 AATTGGTATTGCCAGTTTATTGG - Intergenic
974240110 4:59235879-59235901 TAGTGGTAATGCCAGAATCTGGG - Intergenic
974678439 4:65128190-65128212 TGGTGGTGTTAGCAGTGTATGGG - Intergenic
975586489 4:75955295-75955317 TGGTGGTATATCCAGTGCATTGG + Intronic
975632243 4:76415777-76415799 TAACGGTAATGCCAGTGTCTGGG + Intronic
976254404 4:83085066-83085088 AAGCGGTAATGCCAGTGTCTGGG + Intergenic
980556617 4:134414687-134414709 CAGTGGAATTACCAGTGTGTGGG + Intergenic
982395134 4:154907907-154907929 AAGTGGTAATGCCACTGTCTTGG - Intergenic
986837284 5:11652544-11652566 TATTGTTATTGCTAGTCTATAGG + Intronic
986861974 5:11936988-11937010 GAGTGGTTCTGCCAGTCTATGGG + Intergenic
989442021 5:41483873-41483895 TAGTGGTGTTGACAGTATTTTGG - Intronic
989667252 5:43869294-43869316 TATTGTTATTGACAGTGCATGGG + Intergenic
994818304 5:104613271-104613293 AAGTGGTATGGCCAGAGGATTGG + Intergenic
997631315 5:135370891-135370913 TAATGGTATTGCCATTCTGTAGG + Intronic
1002550874 5:179990686-179990708 TAGCGGTAACGCCAGTGTCTGGG - Intronic
1006368743 6:33631774-33631796 AAGTGGTAACGCCAGTGTCTGGG - Intronic
1006559753 6:34900615-34900637 TAGTAGTATTGCCATTTTACTGG + Intronic
1007804931 6:44435604-44435626 CAGTGGTGTGACCAGTGTATTGG + Intronic
1008003190 6:46382211-46382233 TATTAGTATTCCCATTGTATAGG - Intronic
1008038689 6:46774329-46774351 TAGTGGTATTGCAAACATATTGG + Intergenic
1021011411 7:15472735-15472757 TAGTGGTATTGCCAGTGTATAGG - Intronic
1021411802 7:20337559-20337581 TACTGTTATTCCCATTGTATAGG + Intronic
1023021830 7:36017989-36018011 TAGCGGTAACGCCAGTGTCTGGG - Intergenic
1023220990 7:37920184-37920206 TGGTGGTATTGCCAGGCGATGGG + Intronic
1023788753 7:43735215-43735237 AAGCGGTAATGCCAGTGTCTGGG - Intergenic
1027618998 7:80459823-80459845 ATTTGGTATTGCCAGTGTTTTGG - Intronic
1027917410 7:84343262-84343284 TAGTTGAATTGTGAGTGTATTGG + Intronic
1029381492 7:100218112-100218134 TAGTGGTAATGCCAGTGCCTGGG - Intronic
1029400924 7:100345425-100345447 TAGTGGTAATGCCAGTGCCTGGG - Intronic
1031289907 7:119921249-119921271 TAGGGGTAGTGACAGTGTAGAGG - Intergenic
1033758709 7:144418596-144418618 CAGTGGAAGTGCCAGTGGATCGG + Intergenic
1035324343 7:158055308-158055330 TAGCGGTAACGCCAGTGTCTGGG + Intronic
1036991933 8:13607993-13608015 AAGCGGTAATGCCAGTGTCTGGG + Intergenic
1041596893 8:59665723-59665745 AAGCGGTAATGCCAGTGTCTGGG + Intergenic
1042173427 8:66015143-66015165 TAATGCTATTGCCAGGATATCGG - Intergenic
1045276185 8:100707869-100707891 TAGTGGTAACGCCAGCGTCTGGG - Intronic
1046318540 8:112539185-112539207 CAGTGTTATTGCCACTGTAGTGG - Intronic
1046413891 8:113884798-113884820 AAGCGGTAATGCCAGTGTCTGGG - Intergenic
1046638862 8:116703303-116703325 TAGTGGTAATGCCAATGCCTGGG + Intronic
1050744569 9:8860093-8860115 AAGTGGGATTGCCAGTTTATGGG - Intronic
1051928538 9:22357681-22357703 TAGTGGGGTTGCCAATTTATTGG + Intergenic
1052339509 9:27351457-27351479 TAGTGGAAATGCCATTGTAAAGG + Intronic
1056933978 9:90901769-90901791 TAGTGGTAACGCCAGTGCCTGGG + Intergenic
1057751067 9:97793661-97793683 AAGTGGAAGGGCCAGTGTATTGG + Intergenic
1058294953 9:103294667-103294689 AAGCGGTAATGCCAGTGTGTGGG - Intergenic
1061066320 9:128279841-128279863 AAGCGGTAATGCCAGTGTCTGGG - Intronic
1061535349 9:131244915-131244937 TAGCGGTAACGCCAGTGTCTGGG + Intergenic
1061785496 9:133025491-133025513 TAGCGGTAATGCCAGCGTCTGGG + Intergenic
1062173892 9:135150179-135150201 AAGCGGTAATGCCAGTGTCTGGG - Intergenic
1062210510 9:135361195-135361217 TATTGCTATTCCCAGTCTATAGG + Intergenic
1062377725 9:136270749-136270771 AAGCGGTAATGCCAGTGTCTGGG - Intergenic
1062639481 9:137511111-137511133 TAGCGGTAGTGCCAGTGCCTGGG + Intronic
1188212562 X:27442558-27442580 TAGCGGTAATGCCAGCGTCTGGG - Intergenic
1188955710 X:36433289-36433311 TAGTGGTAGCGCCAGTGCCTGGG - Intergenic
1189762517 X:44336451-44336473 AATTGGTATTGCCAGTGTTTTGG - Intronic
1190498120 X:51047061-51047083 TGGGGCTATTGTCAGTGTATGGG - Intergenic
1192307068 X:69972675-69972697 TACTGTTATTGCCATTTTATAGG - Intronic
1192463606 X:71339285-71339307 TAGTGGTATTTCCAGTCTAGTGG + Intergenic
1195242404 X:102965535-102965557 AAAGGGTATTCCCAGTGTATAGG + Intergenic
1195651476 X:107289507-107289529 GAGTGCTTTTGCCACTGTATTGG - Intergenic
1198272307 X:135066396-135066418 TAGCGGTAGTGCCAGTGCCTGGG + Intergenic
1198287494 X:135206633-135206655 TAGTGGTAACGCCAGCGTCTGGG + Intergenic
1198344743 X:135748245-135748267 TAGCGGTAACGCCAGTGTCTGGG - Intergenic
1198453916 X:136796359-136796381 TAGTGCTATTGTGGGTGTATTGG + Intergenic
1198502313 X:137263523-137263545 ATGTGGTATTGCCAGTGTTTTGG - Intergenic
1198998705 X:142606851-142606873 TAGTGGTAATGCCAGCATCTGGG - Intergenic
1200412636 Y:2876789-2876811 TAGTGGTAATGCCAGCATCTGGG + Intronic