ID: 1021012038

View in Genome Browser
Species Human (GRCh38)
Location 7:15481753-15481775
Sequence GAAAATGCATAAATGCATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 466
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 428}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021012038_1021012042 24 Left 1021012038 7:15481753-15481775 CCCTGATGCATTTATGCATTTTC 0: 1
1: 0
2: 2
3: 35
4: 428
Right 1021012042 7:15481800-15481822 TTTTTTTTTTTTGCTAAATCAGG 0: 4
1: 14
2: 202
3: 1661
4: 12512

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021012038 Original CRISPR GAAAATGCATAAATGCATCA GGG (reversed) Intronic
901848402 1:11999327-11999349 GAAGATGCACTAATGCAGCAGGG - Intronic
905314153 1:37070386-37070408 GAAAAGGCTTAACAGCATCAGGG + Intergenic
906882985 1:49613012-49613034 GAAAATGTACATATACATCATGG + Intronic
907891198 1:58637974-58637996 GAAAATGTATATATACATGATGG - Intergenic
908245578 1:62225213-62225235 AAAAATACAAAAATCCATCATGG - Intergenic
908782706 1:67706222-67706244 GAAAAAGCATATGTGAATCAAGG + Intronic
908874132 1:68650437-68650459 GAAAATGCAAATAAACATCATGG - Intergenic
909924225 1:81419615-81419637 GAAAATGCATAAATATCTCTAGG + Intronic
912610458 1:111037380-111037402 GAAAATGTACATATGCATAATGG + Intergenic
914007433 1:143744603-143744625 GCAAATGCATAGAAACATCAAGG - Intergenic
914646249 1:149655086-149655108 GCAAATGCATAGAAACATCAAGG - Intergenic
914832251 1:151178979-151179001 GTTAATGAATAAATGAATCAAGG + Intronic
917898989 1:179522926-179522948 GAAAATGCACAAATAAATTATGG - Intronic
919118840 1:193314224-193314246 GAGAATGAATAAATGAATCCTGG - Intergenic
919141358 1:193575920-193575942 AAAAATACATAAATAAATCAGGG - Intergenic
919143165 1:193599285-193599307 GAAAGTGCTTATATGCCTCATGG + Intergenic
919710275 1:200720586-200720608 CAAAATGCATAAACAAATCATGG + Intergenic
920724184 1:208418333-208418355 GAACATGCATTAATGCCTCATGG + Intergenic
922138198 1:222853521-222853543 GAAAATGTATATATACACCACGG + Intergenic
923317103 1:232791457-232791479 CAAAATGTAAAAATGTATCATGG - Intergenic
923414367 1:233740227-233740249 AAAAATGCATTTATGCTTCAAGG + Intergenic
924331237 1:242942675-242942697 TAAAATGCATCTATGGATCAGGG - Intergenic
924848565 1:247799512-247799534 GAATATGTATATATACATCATGG - Intergenic
1063486008 10:6421704-6421726 AAAAATGCTTAAGTGCATCTAGG - Intergenic
1063607127 10:7532630-7532652 CAAAATGGATAAATGCTTGAGGG - Intergenic
1063693062 10:8305616-8305638 TAGAATGAATAAATGCATCAAGG + Intergenic
1064233046 10:13546775-13546797 GAAAATCCATAATGTCATCAAGG - Intergenic
1064572339 10:16707105-16707127 GAAAATGTATATATACATAATGG - Intronic
1065497409 10:26343464-26343486 GATAATCCACAATTGCATCATGG + Intergenic
1065508565 10:26454777-26454799 TGCAATGCATAATTGCATCATGG - Intronic
1065640073 10:27772619-27772641 GAAAATGTATATATACACCATGG - Intergenic
1066674434 10:37873632-37873654 AAAAATGGATAAATGCAGTATGG - Intergenic
1067302907 10:45030822-45030844 GGAAATGCAGAAATGCAGGAGGG - Intergenic
1067932959 10:50581929-50581951 GATATTTCATAAATGGATCATGG - Intronic
1068077856 10:52279576-52279598 CAAAATTCATAAGTGAATCAAGG - Intronic
1068255406 10:54502968-54502990 GAAAAAGCATAAACCCATGAAGG - Intronic
1068413102 10:56683496-56683518 CAAAATGGATAAATGCTTTAGGG - Intergenic
1068528126 10:58154322-58154344 GCAAAAGCATGAATGTATCATGG - Intergenic
1069022768 10:63507138-63507160 GTAAATGCATAAATGAGTTAAGG - Intergenic
1069304622 10:66953386-66953408 GAAAATGAATACATGAATCAAGG + Intronic
1069485563 10:68820581-68820603 GAAAATGTACATATGCACCATGG - Intergenic
1071016915 10:81008330-81008352 GAAAATGCATAAAAACAGTAAGG + Intergenic
1071287877 10:84165694-84165716 GCAAATGCATAAAAGCATGAGGG + Intergenic
1071973870 10:90935593-90935615 GAAAATGCATCACAGCAGCAAGG - Intergenic
1072112001 10:92331281-92331303 GAAAAAGCACAACTGAATCAAGG - Intronic
1072529814 10:96308379-96308401 AAATATGCAAAAATGCCTCAAGG - Intronic
1073270201 10:102256414-102256436 TAAACTGTATAAATGCCTCAAGG + Intronic
1074699524 10:116080930-116080952 GCAAATACATTAATGCAGCAAGG + Intronic
1075014715 10:118902181-118902203 CATAATGTAAAAATGCATCAAGG - Intergenic
1078001970 11:7504160-7504182 GAACAGGCATAAAGGCAGCAAGG + Intronic
1078560919 11:12371719-12371741 GAAAATGCACATATACACCATGG + Intergenic
1078645625 11:13139280-13139302 GAAAATGTACATATACATCATGG - Intergenic
1079304852 11:19312944-19312966 GAAAATACTTTAAAGCATCAAGG + Intergenic
1079568257 11:21910029-21910051 GTATATGCTAAAATGCATCATGG - Intergenic
1079751466 11:24204028-24204050 GAAAATATATAAATGTATTAAGG + Intergenic
1079780859 11:24602437-24602459 GAAAATAAATAAATGCACTATGG + Intronic
1080713697 11:34775858-34775880 TAAAATGGATAAATGCATTTTGG - Intergenic
1080996419 11:37607913-37607935 GAAAATGTACCCATGCATCATGG + Intergenic
1082199355 11:49344996-49345018 GAAAATGTATACATACAACATGG - Intergenic
1082703845 11:56468049-56468071 GAAAATGCACATATACATCATGG + Intergenic
1082902830 11:58274473-58274495 GAAAATGCATCAGTGTACCATGG - Intergenic
1082938112 11:58675397-58675419 AAAAATGCAAATATGCATGAGGG - Intronic
1083014579 11:59440005-59440027 GATAATGTATAAAGGGATCATGG - Intergenic
1085263326 11:75221252-75221274 GAGAACGCATGAATGCATAAAGG - Intergenic
1086057675 11:82666459-82666481 GAAAATGGATAAAGGAATGATGG - Intergenic
1088940511 11:114450190-114450212 GCAAATGCATATATGTACCAAGG - Exonic
1090630468 11:128643060-128643082 GAAAATGTATATATACACCATGG + Intergenic
1091531343 12:1359125-1359147 GAAAAAGCATAACAGCTTCAGGG + Intronic
1092086391 12:5766316-5766338 TAAAATGGATAAATGCATTTTGG + Intronic
1093260212 12:16927293-16927315 GGAAATGCATATATGTATTATGG - Intergenic
1093532903 12:20188225-20188247 GAAAATGCAGAAATGAGTAAGGG - Intergenic
1093562397 12:20557268-20557290 TAAAAAGCATAAATGCGTCATGG - Intronic
1093707086 12:22286454-22286476 AAAAATTCAGAAATGAATCATGG - Intronic
1094184065 12:27622322-27622344 GAAAATGAATCAATTCATGATGG - Intronic
1094361892 12:29639744-29639766 TAAAATGCATACATACATTATGG + Intronic
1094422272 12:30283195-30283217 GACAATACATAAATGGAGCATGG - Intergenic
1094715307 12:33008036-33008058 GAAAATGCAGAAATACCTTAAGG - Intergenic
1095622596 12:44275964-44275986 GACAAGGCATAAATGCTTGAAGG + Intronic
1098395155 12:70009759-70009781 GAAATTGTATAAATACATAAAGG + Intergenic
1098481737 12:70969681-70969703 GAAAATGTATATATACACCAAGG - Intergenic
1098610619 12:72452919-72452941 GAAAATGTTTAATTGCCTCATGG - Intronic
1098809984 12:75075322-75075344 GATAATGCAAAAAGGAATCATGG - Intronic
1100055300 12:90502303-90502325 GACAATACATAAATGAATGAGGG - Intergenic
1101056749 12:100925037-100925059 GAAAATGCATAAACTTATAAAGG - Intronic
1101643158 12:106603092-106603114 GAAAATGAATAAATGGATGCAGG + Intronic
1102013485 12:109633040-109633062 GAAACTCCATAAATGCTTAAAGG + Intergenic
1102418354 12:112784070-112784092 GAAAATGAATGAATTCATAAAGG - Intronic
1103136169 12:118509768-118509790 AAGAAGGCTTAAATGCATCAAGG - Intergenic
1103138050 12:118524915-118524937 GAAAATACAGAAAAGGATCAAGG + Intergenic
1104110324 12:125698449-125698471 GAAAATGCATGAGTGCAGGATGG - Intergenic
1104262353 12:127196101-127196123 GAAAATGTACATATACATCATGG + Intergenic
1107563092 13:41575044-41575066 GAAAATGTATATATACACCATGG + Intronic
1107627417 13:42303985-42304007 AACAATACATAAATGCAACAGGG - Intronic
1108613615 13:52108729-52108751 GAAAATACAAAAATGAATAAGGG + Intronic
1109270740 13:60252530-60252552 GAATTTGCATAGAGGCATCATGG + Intergenic
1109743177 13:66583214-66583236 TAAAATAAATAAATGCATAAAGG + Intronic
1109916602 13:68995472-68995494 AAAAATGCATAAACATATCAAGG - Intergenic
1110055468 13:70964988-70965010 GAAAATCAATGAATGCTTCATGG - Intergenic
1110567915 13:76974785-76974807 GACAATGAATGAATGGATCAGGG - Intergenic
1110823024 13:79938151-79938173 GATAAGGCAAGAATGCATCAAGG + Intergenic
1111628565 13:90820122-90820144 GAAAATACATTAATGCTTGAGGG + Intergenic
1112525506 13:100142965-100142987 GAAAAAACATAAATGTATCAGGG - Intronic
1113382391 13:109815847-109815869 CAAGATGCATAGATTCATCAGGG - Intergenic
1113607342 13:111619555-111619577 GGAAATGCATGTATGCATCTTGG - Intronic
1113777511 13:112956475-112956497 ATAAATGCATAAATATATCAGGG - Intronic
1114919882 14:27312858-27312880 CAAAATGCACAAATGAAGCAAGG - Intergenic
1114956088 14:27821373-27821395 GTAAATGGATCAATGCAACAAGG - Intergenic
1115784878 14:36814257-36814279 GAAAAAGCACAAATGCCTCAGGG - Intronic
1115980133 14:39042251-39042273 GTAACTGCAGGAATGCATCAAGG + Intronic
1116300273 14:43171306-43171328 GAAAATGTAGAAATACATGATGG + Intergenic
1118563807 14:67117359-67117381 TAAAAAGCATAATTTCATCAAGG - Intronic
1119903785 14:78283478-78283500 GACAATGCATAAAGGAATAAAGG - Intronic
1122530484 14:102422248-102422270 GAAAATGAATAAATGAATTGTGG + Intronic
1124907120 15:33880320-33880342 GAAAATTGATAAATGCCTTAGGG - Intronic
1125046234 15:35244517-35244539 ATGGATGCATAAATGCATCATGG - Intronic
1125119775 15:36141259-36141281 GAAAATGCATAAACACACCATGG - Intergenic
1125145220 15:36459562-36459584 AACAAAGCATACATGCATCACGG + Intergenic
1125389069 15:39172334-39172356 GAGAGAGCACAAATGCATCAGGG - Intergenic
1126793838 15:52244010-52244032 GAAAATGCATAAGATCAGCAAGG - Intronic
1126897078 15:53269762-53269784 GAAACTACATAAATACACCATGG + Intergenic
1127313443 15:57772451-57772473 GAAAATGAATCAATGCCTCCTGG - Intronic
1127586464 15:60382800-60382822 GAAAATGTGGAAATGCCTCAAGG + Intronic
1127919668 15:63483679-63483701 GAGAATGAATACATGAATCATGG + Intergenic
1129013541 15:72444907-72444929 GAAAAAGCATGAAGGCATGAAGG + Intergenic
1130542900 15:84834854-84834876 TAAAATGCATAAAAGCAGGAGGG - Intronic
1130608568 15:85339605-85339627 GAAAAGGTATTAATGCATCCAGG + Intergenic
1131363761 15:91819614-91819636 GTAAATGCATGAATGCACCAGGG - Intergenic
1131571163 15:93537885-93537907 GAAAATGCTTTAGTACATCATGG - Intergenic
1131598333 15:93822409-93822431 GAGAATGCTTAAACACATCATGG - Intergenic
1131755486 15:95556451-95556473 GAAAATGCTTAAATGCACATAGG - Intergenic
1134143264 16:11740880-11740902 CTAAATGAATAAATGCTTCATGG + Intronic
1134875913 16:17698508-17698530 GAAAATGGATAAATGGTACATGG - Intergenic
1134884959 16:17782318-17782340 GAAAATGGATAAATAAATTAAGG + Intergenic
1135151637 16:20011991-20012013 GGAAATGAAGAAATGAATCAAGG - Intergenic
1135694003 16:24571179-24571201 GAAAATTCAGAAATTCACCAAGG + Exonic
1135801424 16:25500320-25500342 GAAAAAGAATAAATTCATAATGG + Intergenic
1136071328 16:27789262-27789284 GATAATGCAGAAATGGATAATGG + Exonic
1139214230 16:65111774-65111796 AAAAATGAATAATTGCAACAGGG + Intronic
1140801540 16:78492751-78492773 GAATATGCATAATCACATCAAGG + Intronic
1141417024 16:83883610-83883632 CAAAATGCATAAATAAAGCATGG - Intergenic
1141978033 16:87531147-87531169 GAAAATGAATAAAGGTATCAGGG + Intergenic
1144009369 17:11131696-11131718 GAAAATGTATATATACATGATGG - Intergenic
1144707514 17:17379414-17379436 GAAAATGCTAAAATGGATCATGG - Intergenic
1145304071 17:21662240-21662262 GTAAATGAATAAATGCATTGAGG - Intergenic
1145766702 17:27463156-27463178 GCAAATGGATAAATGTATGAAGG - Intronic
1146227936 17:31083338-31083360 GAAAATGAATAAATGAATGAGGG - Intergenic
1146466475 17:33090547-33090569 GAGAATGGATAAATGCAGGAAGG + Intronic
1147450556 17:40501460-40501482 AAAAATGTTTAAATGAATCAGGG + Intronic
1147516949 17:41127616-41127638 GAAAATGAGTAATTACATCAAGG + Intergenic
1148668955 17:49395847-49395869 TAAAACTGATAAATGCATCATGG + Intronic
1149841565 17:59969531-59969553 GAAAATGCATAAATGAGGAATGG - Intronic
1150723822 17:67635727-67635749 GAAAACACAGAAATGCACCAAGG + Intronic
1150915740 17:69435162-69435184 GAAAATGGAAAAATGCATTTTGG - Intronic
1150984622 17:70181923-70181945 ATAAATGCATAAATGAATAAAGG + Intergenic
1152343809 17:79739542-79739564 GAAAATGCAAAAATGAAAGATGG + Intronic
1153235793 18:2985977-2985999 GAAAATGCAGAAATGCACTTAGG - Intronic
1153728772 18:7985752-7985774 TAAAATGGATAAATGCTTGAGGG - Intronic
1153740085 18:8115789-8115811 GAAAATGCACATGTACATCATGG - Intronic
1155805211 18:30162135-30162157 GAAAATGTATAAACACATAACGG + Intergenic
1155815674 18:30305822-30305844 GGAAAGGCCTAAATGCATTATGG + Intergenic
1156212382 18:34958932-34958954 GCAAATGCATAAAAGAATTATGG + Intergenic
1156301451 18:35840068-35840090 AAAAATGTATAAATTCAACAGGG + Intergenic
1156668943 18:39444146-39444168 GAACACAAATAAATGCATCAAGG + Intergenic
1158086851 18:53661635-53661657 GAACATGGACAAATGCATGATGG - Intergenic
1158165061 18:54531021-54531043 GAAAATGGATAAATAAATTATGG - Intergenic
1158213022 18:55071106-55071128 TAATATGCATAAATGCCTCTGGG - Intergenic
1158501619 18:58007566-58007588 GGAGATGCATAAATACATTATGG + Intergenic
1158678651 18:59546615-59546637 GAAAATACAAAAATAGATCAAGG - Intronic
1159444552 18:68525242-68525264 GGAAATGCCTAAATGCAATATGG + Intergenic
1165997770 19:39856824-39856846 GAAAATTCATCAAGTCATCAAGG - Intergenic
1167871369 19:52373272-52373294 CAAAATGCAAAAATACACCAGGG - Intronic
1167929079 19:52849035-52849057 GAAAATGCAAAAATACACAAGGG + Intronic
1168491830 19:56817481-56817503 GATAATGGAAAAATTCATCAAGG - Exonic
925299559 2:2800877-2800899 GAAAATGCACACATGCACCATGG - Intergenic
925591488 2:5514341-5514363 GCAAATCCAGAAATGCAGCAAGG + Intergenic
925876566 2:8316348-8316370 GAAAATGGACTAATGCATGAAGG - Intergenic
926493284 2:13552487-13552509 GAAAATGCAAATATGCACAATGG + Intergenic
929461814 2:42107604-42107626 AAAAGTGAATGAATGCATCAGGG - Intergenic
929560338 2:42952635-42952657 GAAAGAGAATAAATGAATCAAGG - Intergenic
929860320 2:45671471-45671493 TTAAATGCATAAATGGATAATGG - Intronic
929904152 2:46031436-46031458 GAAAATTAATAAATGCTACAGGG - Intronic
930008155 2:46914574-46914596 TTAAATGTATAAATGCAGCATGG - Intronic
930173880 2:48281408-48281430 GAGAAAGAATAAATGAATCATGG - Intergenic
930207552 2:48603157-48603179 GAAAATGTATATAAGCTTCACGG - Intronic
931530048 2:63203912-63203934 GAAAATGTATATATGCACAATGG - Intronic
932059838 2:68485015-68485037 GAAAGTACATACATGCATTATGG + Intronic
932763280 2:74454582-74454604 GGAAATGAATAAATGAATTACGG - Intergenic
933451509 2:82458893-82458915 GAAAAGGAAAAAATGCCTCATGG - Intergenic
933457558 2:82535920-82535942 GAAAATGGATATGTGCATCATGG - Intergenic
933815174 2:86061644-86061666 AAAAATGGATAAATACATGATGG + Intronic
933904881 2:86882084-86882106 GAAAATGTATATATACACCATGG + Intergenic
935851797 2:107229721-107229743 GAAAATGTATATATACACCATGG - Intergenic
936367347 2:111870078-111870100 GAAAATGTATATATACACCATGG - Intronic
937014540 2:118592469-118592491 GAAAATGCATGAAGGAGTCAAGG + Intergenic
937300824 2:120840306-120840328 GAAAATGCATAACAGAAACATGG - Intronic
937941885 2:127292615-127292637 TAAACTGCATAATTCCATCAGGG + Exonic
938032117 2:128003832-128003854 CAAAAAGCAGAAATGCTTCAAGG + Intronic
938883181 2:135613519-135613541 ACAAATGCATAAATCCAGCAGGG + Intronic
939062790 2:137444225-137444247 GAAAATGTATACATTCACCAAGG + Intronic
939463938 2:142532736-142532758 AAAAATGGATAAAAGCATTAAGG + Intergenic
939644211 2:144676480-144676502 GAAAATCCATATCTCCATCACGG - Intergenic
940688009 2:156878459-156878481 GTATATGCATAAATACATAAAGG + Intergenic
940717207 2:157239765-157239787 GAAAAAGGATAAATGCCTGAGGG + Intergenic
941194690 2:162434434-162434456 GCAAAAGCATAAAAGCATGATGG - Intronic
941589753 2:167404784-167404806 GAAAATGAATGAATGCCTCCTGG + Intergenic
942650111 2:178157667-178157689 GAGAATCCATCAATCCATCACGG + Intergenic
942809256 2:179977355-179977377 GAAAATGTATACATGTATAATGG + Intronic
943574108 2:189610712-189610734 TCAAATGTATAAATGAATCAGGG + Intergenic
943758431 2:191583426-191583448 GAAATAGCATAAATGCAGCCGGG + Intergenic
943856321 2:192797460-192797482 TAAAATGCATAAATAAATTATGG - Intergenic
944217073 2:197267309-197267331 GAAAAATGATAAATGCATAAAGG - Intronic
945674173 2:212834846-212834868 CACAAAGCATAAATGCATAAAGG - Intergenic
948081735 2:235212082-235212104 GAAAACGAATAAATGAATTATGG - Intergenic
948153075 2:235759711-235759733 GAAAATACATAAATGTTTGATGG + Intronic
1170796172 20:19548862-19548884 ACAAATGCCTAAATGCATCATGG + Intronic
1171521629 20:25780058-25780080 GTAAATGAATAAATGCATTGAGG - Intronic
1171555212 20:26075993-26076015 GTAAATGAATAAATGCATTGAGG + Intergenic
1171754025 20:29084100-29084122 GAAAATGGATTAATGCAAAAAGG - Intergenic
1173152850 20:40582644-40582666 GTGAATGCATGAATGAATCAAGG + Intergenic
1173630328 20:44508802-44508824 GTGAATGCATAAATACATAAAGG + Intronic
1173870471 20:46338872-46338894 GAAAATACATAGATTTATCAAGG - Intergenic
1174942733 20:54948646-54948668 CAAAATGTAGAAATTCATCAAGG - Intergenic
1175618989 20:60427385-60427407 GAATTTTCAAAAATGCATCAAGG + Intergenic
1177252281 21:18609755-18609777 GGAAATGTAGAGATGCATCAAGG + Intergenic
1177742886 21:25175163-25175185 GAACATGTATAAATGAAGCAAGG + Intergenic
1178477561 21:32950653-32950675 GAAAATGCACAAATGAAGAAGGG - Intergenic
1178904142 21:36622696-36622718 CAAAAAGCATAAATGTATAAAGG + Intergenic
1184348373 22:43926577-43926599 GAAAATGCACAATGACATCATGG - Intronic
949358961 3:3211764-3211786 TAAATTGCACAAATGCATGATGG + Intergenic
950175458 3:10870334-10870356 GAGAAAGCATAAATGAAACATGG + Intronic
951398532 3:22201725-22201747 TAAAATGCATACATGCAGGAAGG + Intronic
951781371 3:26366630-26366652 GAAAATCAATAAATACATCTTGG - Intergenic
954907577 3:54076061-54076083 GAAAATGTATAAATTCAAGAGGG + Intergenic
955799845 3:62674737-62674759 GCAAATGCACAAAGGTATCAGGG + Intronic
956325422 3:68047361-68047383 AAAAATGCATAAATTCAAGAAGG + Intronic
956350746 3:68333276-68333298 GAAAATGCAAATATACACCATGG + Intronic
957518923 3:81294081-81294103 GAGCATGAATAAAGGCATCAAGG - Intergenic
957632499 3:82735331-82735353 AAAAATACACAAATGCATAAAGG - Intergenic
957866495 3:86031177-86031199 GCAAGTGCATGAATGCCTCATGG - Intronic
958045601 3:88280374-88280396 GAAAATGCAAAAGAGCAGCAAGG + Intergenic
958255775 3:91323227-91323249 GAAAATGGATAAATGGACTATGG + Intergenic
958834491 3:99128670-99128692 TAAAATGCATAAAGGGGTCAGGG + Intergenic
959245330 3:103861136-103861158 GAAAATGTATATATACACCATGG - Intergenic
959492032 3:107001693-107001715 GAGAATGTATAAAAGCTTCACGG + Intergenic
959529826 3:107421789-107421811 TAAAATGTATAAATGGGTCATGG - Intergenic
960242955 3:115366857-115366879 GAAAATGTATATATACACCATGG + Intergenic
960985652 3:123278913-123278935 TAAATTGCACAAATGCAACATGG + Intergenic
961030029 3:123594351-123594373 TAAAATAAATAAATACATCATGG + Intergenic
961031117 3:123604801-123604823 CAAAAGGCATAAATCCATAAGGG - Intergenic
961176461 3:124839559-124839581 GAAAATCCATAAAATCCTCAAGG + Intronic
961178391 3:124855387-124855409 CAAAATGCATATTTGCCTCAGGG - Intronic
961210482 3:125121266-125121288 GAAAATGAATTAATCCATGAGGG + Intronic
961554200 3:127686719-127686741 GAAAATGAATGAATGAATGAGGG - Intergenic
961586725 3:127934643-127934665 GAAAATTCTTAAAAGCAGCAAGG + Intronic
961907573 3:130278263-130278285 CAAAATGTATAAATGCATACAGG + Intergenic
962661838 3:137609509-137609531 GAAAATGAAGAAATGAATAAAGG - Intergenic
963436486 3:145274805-145274827 GGAAAAGCAGAAATGCAACAGGG - Intergenic
964510657 3:157447326-157447348 GACAATGCACATATGGATCAAGG - Intronic
965589203 3:170346762-170346784 GAAAATGCATAAATTCCACTTGG + Intergenic
967530501 3:190544070-190544092 GAAAATGCATGTATGTATTAGGG - Intronic
970737224 4:19187097-19187119 GAAAATGTAAAACTGCATTAGGG + Intergenic
970900124 4:21149232-21149254 TTAAATGCATAAATGCATGAAGG - Intronic
971426119 4:26517379-26517401 GAAAATGGATAAATAAATAATGG - Intergenic
972240287 4:37183673-37183695 GAAAATGTATAAAAGAATAAAGG + Intergenic
972294158 4:37720533-37720555 GAAAATGTATATATACATCATGG + Intergenic
972512793 4:39785369-39785391 GAAAATGAGTAACTGCAACAAGG + Intergenic
973243315 4:47982740-47982762 GAAAATGAATCAATGAATTATGG - Intronic
974198047 4:58602239-58602261 AATAATGCATAAACTCATCAAGG - Intergenic
974700030 4:65431025-65431047 GCTATTACATAAATGCATCATGG - Intronic
974882082 4:67772002-67772024 GTAAATGAATAAATGAATGAAGG + Intergenic
975312422 4:72917548-72917570 GGAAATGCATAAATGCTGGAAGG - Intergenic
975660553 4:76684597-76684619 GTAAAGGCATTAATGCATCCTGG - Intronic
976437252 4:85032441-85032463 CAAAATGCACAAATGAAGCAAGG + Intergenic
976980690 4:91223184-91223206 GAAAATGTAAAAATATATCAAGG + Intronic
977325200 4:95565772-95565794 GAAAATGAATATATGCACAATGG - Intergenic
977381459 4:96279413-96279435 GAACATGCAAAAGTGCATGAGGG - Intergenic
977984893 4:103371609-103371631 GAAGATACAGAAATGCATCCAGG - Intergenic
978094980 4:104765323-104765345 TAAAATGCATTAATTCATCCTGG + Intergenic
978107680 4:104923987-104924009 GTGAATGGAAAAATGCATCAAGG - Intergenic
978107763 4:104924954-104924976 GAAAATGTATAACAGTATCAGGG - Intergenic
979506543 4:121503477-121503499 GAAAATGTATATATACACCATGG - Intergenic
980340773 4:131543054-131543076 GAAAATGCATAAATCAATCTAGG - Intergenic
980599628 4:135004669-135004691 CAAAATGCATTCATTCATCAAGG + Intergenic
980751868 4:137100891-137100913 GAAAATGTACATATACATCAAGG + Intergenic
980862407 4:138515402-138515424 GAAAATGGATAAACAAATCATGG - Intergenic
981646837 4:147008549-147008571 GAAAATGTAGAAATGTGTCAGGG + Intergenic
981767064 4:148263069-148263091 GAAAAGGAATGAATGCATAAGGG - Intronic
982275315 4:153631735-153631757 GTAAATGCCTAAATTCTTCAAGG + Intronic
982689345 4:158530535-158530557 GAAATTGCAGAACTGCCTCATGG + Intronic
982870039 4:160567586-160567608 AATATTGTATAAATGCATCAGGG - Intergenic
985140699 4:186837653-186837675 GAAAATGCACATATACACCATGG - Intergenic
985320329 4:188703439-188703461 GAAAATGCAACAATGCATGCTGG - Intergenic
986060619 5:4186939-4186961 GAAAATGGACAAATACACCATGG - Intergenic
986734463 5:10658532-10658554 GAAAATGGTTAAATGAACCATGG - Intergenic
986946808 5:13030888-13030910 GAAAATGCATAAATGATTCATGG + Intergenic
986958728 5:13188517-13188539 GAGAATGAATAATTGCATAATGG + Intergenic
987191661 5:15484897-15484919 GAAGATGCATAAAGGCACAAAGG + Intergenic
988342785 5:29996100-29996122 GAAAATGAAGAAATCCAACATGG - Intergenic
988386477 5:30572634-30572656 GCAAATACAGAAATACATCAAGG + Intergenic
989114192 5:37936337-37936359 TAAAATGAATAAATGCATTGTGG - Intergenic
989299215 5:39869094-39869116 GAAAATGAATACAAGGATCAAGG + Intergenic
989693932 5:44177015-44177037 GAAAATGTATATATACACCATGG - Intergenic
990589861 5:57250838-57250860 GAAAATACATAAATGCGGCCAGG - Intronic
990722963 5:58718772-58718794 GAATATGCATAAATGAAGCCAGG + Intronic
991478933 5:67055807-67055829 GAAAATGGATAAATGAATTGTGG + Intronic
991695742 5:69269291-69269313 GAAAATGCATAAAGGCTTACCGG - Exonic
992954965 5:81898964-81898986 GAAAATGCATATATACACTATGG + Intergenic
993484324 5:88463686-88463708 GAAAATGTATATATACACCATGG - Intergenic
994226266 5:97254613-97254635 GAAAATGAAAAAATTCACCAGGG - Intergenic
994733285 5:103520381-103520403 AAAAATGCCAAAATGCATGAAGG + Intergenic
995140037 5:108725514-108725536 ATAAATGAATAAATGAATCAAGG + Intergenic
995431082 5:112078310-112078332 GAAAATGTACACATACATCATGG - Intergenic
995661657 5:114490411-114490433 GAGCATGCATAAAGTCATCATGG - Intronic
996384347 5:122895284-122895306 GAAAATGCATAAGTTAATCATGG - Intronic
996511109 5:124316859-124316881 GGAAATGAATAAATGCATTATGG + Intergenic
998440044 5:142151748-142151770 GAGAATTCATAAATGCAGGAAGG - Exonic
999405812 5:151305716-151305738 ATAAATGCATAAGTGCAACAGGG - Intergenic
1001112762 5:168911556-168911578 GAAAATACATACATGCATTCTGG + Intronic
1001653747 5:173332481-173332503 GAAAATGAAAAAAGGTATCAAGG + Intergenic
1003750045 6:9044896-9044918 GGAAATGCATAAATTCTTCTAGG - Intergenic
1004438797 6:15626151-15626173 TAAAATTTATAAATGCATCTAGG - Intronic
1004624331 6:17360630-17360652 GAAAATGTACATATACATCACGG + Intergenic
1004990026 6:21126496-21126518 GCAGATGCATAAAAGCATCAAGG - Intronic
1005267236 6:24125276-24125298 AAAAAAGCACAAATGCATAAAGG - Intergenic
1005480227 6:26248670-26248692 GTAACTGCATAAATGAATTATGG + Intergenic
1006261343 6:32874151-32874173 GAAAATGTACATATGCACCATGG - Intergenic
1007872492 6:45056460-45056482 GAAAATGTATAGGTACATCATGG + Intronic
1008061335 6:47000280-47000302 GAAAATGCATAATGGCCTGAAGG + Exonic
1008592332 6:53006836-53006858 GAAAATGGTTAAATGGATTATGG - Intronic
1008999571 6:57697938-57697960 GAAAATGGATAAATGCACTATGG - Intergenic
1009188057 6:60597362-60597384 GAAAATGGATGAATGCCTTATGG - Intergenic
1009551126 6:65092978-65093000 GATAATGCATCAATGTATTAGGG - Intronic
1010405811 6:75504623-75504645 GAAAATGAATACATGTATTATGG + Intergenic
1010948894 6:82011571-82011593 GTAAATGCATAAAGCCATTATGG + Intergenic
1011523988 6:88242773-88242795 TAAAATGGATAAATAAATCATGG + Intergenic
1014066130 6:117128076-117128098 GTAAATTCATAAATTCATAAAGG - Intergenic
1015619096 6:135111292-135111314 AAAAATGGAAAAATGCAACATGG + Intergenic
1016249949 6:142028758-142028780 GAAAATGTATATATACACCATGG - Intergenic
1016257763 6:142129384-142129406 GAAAATTTATAAATGTATCCTGG + Intergenic
1016384895 6:143521225-143521247 GAAAATAAATAAATGCAATACGG + Intergenic
1017958187 6:159197564-159197586 GAAAAGTCTTAAATACATCAAGG + Exonic
1018332870 6:162750254-162750276 TAAATTGCATATATGCATCTAGG - Intronic
1018550005 6:164985044-164985066 GTAAATTCATAAATATATCATGG - Intergenic
1020145752 7:5641436-5641458 GAAAATAAATAAATGCTTAATGG - Intronic
1020896206 7:13943630-13943652 GCAAATGGATAAATAAATCATGG + Intronic
1021012038 7:15481753-15481775 GAAAATGCATAAATGCATCAGGG - Intronic
1021210853 7:17850090-17850112 GTAAATGTATAAATAAATCAAGG + Intronic
1021816792 7:24454850-24454872 GAAAATGCATCAAAGCATCAAGG - Intergenic
1022418854 7:30201643-30201665 AAAAATGCATGAGTGCATGAGGG - Intergenic
1023490917 7:40740717-40740739 TATTATGAATAAATGCATCAAGG + Intronic
1023505421 7:40895090-40895112 GAAAATGTACATATTCATCATGG + Intergenic
1023747679 7:43336906-43336928 GAAAATGTATATATACACCATGG - Intronic
1023880804 7:44320256-44320278 GGAAAAGCACAAATACATCATGG + Intronic
1024684770 7:51733544-51733566 GAAAATGGATTAATACACCAGGG - Intergenic
1025270913 7:57515184-57515206 GAACATGCATAAATGCTTTAAGG + Intergenic
1025282077 7:57634832-57634854 GTAAATGAATAAATGCATTGAGG - Intergenic
1025302653 7:57830685-57830707 GTAAATGAATAAATGCATTGAGG + Intergenic
1026621032 7:71950106-71950128 CAAAATGCACAAATGAAGCAAGG - Intronic
1027422956 7:78035033-78035055 GCAAATGCAGAAGCGCATCATGG - Intronic
1027578158 7:79957453-79957475 GAAAAAGCATATATTCATCATGG - Intergenic
1027578259 7:79958711-79958733 TAAAATACATAAAAGCATCATGG - Intergenic
1027881348 7:83842388-83842410 GAAAATACATAAATGTACCCTGG + Intergenic
1028345612 7:89778589-89778611 AAAATTACATAAATGGATCAAGG - Intergenic
1029673751 7:102051698-102051720 GTAAATGCATAAATACCTCTGGG + Intronic
1030160084 7:106498591-106498613 GAAAATAAATATATGCATGAAGG + Intergenic
1030185844 7:106760861-106760883 GATAATGCAGAAAAGCATAAAGG + Intergenic
1030399415 7:109029568-109029590 GAAAATAGATTAATGAATCAGGG + Intergenic
1030401511 7:109057439-109057461 GAAAATGTATATATACACCATGG - Intergenic
1030880774 7:114876285-114876307 AAAAATGGAAAATTGCATCATGG + Intergenic
1031258239 7:119483586-119483608 GAAAATGTATATATACACCATGG - Intergenic
1031444397 7:121832754-121832776 AAAAATTCACAAATGCATCATGG - Intergenic
1031581047 7:123475490-123475512 GAGTATCCATAAATGGATCAAGG - Intronic
1033028655 7:137803093-137803115 AAAGATCCATAAATGCATCCTGG + Intronic
1033472349 7:141661427-141661449 GAGGATGGATAAATCCATCAGGG + Exonic
1033937164 7:146600757-146600779 GGAAATGCATAGATGAATAAGGG - Intronic
1037344221 8:17881050-17881072 AAAACTGCATACATGCAACAAGG + Intronic
1039367349 8:36944244-36944266 GAAAATGTATATATGCACCATGG + Intergenic
1039908118 8:41801050-41801072 GAAAAGGAATAAATGAATCCTGG - Intronic
1042960460 8:74298379-74298401 GGACATGAATAAATGCATCTAGG - Intronic
1043038927 8:75234796-75234818 GAAAATGCATAATTATAGCAAGG - Intergenic
1043163230 8:76871931-76871953 GAGAATGCGTTAATGCATCAAGG + Intergenic
1043276024 8:78394023-78394045 GAAAAAGCATGAATGCATTCAGG + Intergenic
1043450513 8:80361643-80361665 GAGAGTTCATAATTGCATCATGG - Intergenic
1043996766 8:86827163-86827185 GAAAATACCAAAATGCAACAAGG + Intergenic
1044526742 8:93260994-93261016 GAGAATGCACAAATGCCTCCAGG - Intergenic
1045348923 8:101320266-101320288 GTGAATGGATAAATCCATCATGG - Intergenic
1046202457 8:110945170-110945192 GAAAATGTATATATACACCATGG - Intergenic
1046215759 8:111144012-111144034 CAAAAAACATAGATGCATCAGGG + Intergenic
1046258722 8:111737219-111737241 TAAAATGCAAAAATGCAATAAGG - Intergenic
1046414414 8:113892952-113892974 TAAAATGTATAAATCCCTCATGG - Intergenic
1046454940 8:114446415-114446437 GAAAATGTAAATATACATCATGG + Intergenic
1046866296 8:119154417-119154439 GAAACTGCCTAAATGCATTTTGG + Intergenic
1046990583 8:120448448-120448470 AAAAATGGATAAATGGATGAGGG - Intronic
1047460300 8:125057538-125057560 GAAAAGTAAGAAATGCATCAGGG - Exonic
1047889151 8:129288136-129288158 CAAAATGCATAAATAAAGCAAGG - Intergenic
1048133945 8:131727644-131727666 GAAAATTCTTAAATCCAGCAAGG + Intergenic
1048217756 8:132512093-132512115 GAAAATGCATAAATGTGGAAGGG - Intergenic
1050045708 9:1542675-1542697 GAAAATGTACATATACATCATGG - Intergenic
1050146287 9:2571490-2571512 GAAACTGCACACATGTATCAGGG - Intergenic
1050726122 9:8651218-8651240 GAAAATGCAGAGATCCATCGTGG - Intronic
1050764542 9:9115853-9115875 GAAAATGTATATACCCATCATGG + Intronic
1051139762 9:13965647-13965669 GAAAATGGTTGACTGCATCAAGG + Intergenic
1051672990 9:19531046-19531068 GAAAATTAAAAAAAGCATCAGGG + Intronic
1051845886 9:21450558-21450580 GAAAATGAATAAATGAATGAAGG + Intergenic
1052184058 9:25568200-25568222 GAAAATTTTTCAATGCATCATGG - Intergenic
1052636771 9:31116561-31116583 GAAAATGTACAAATACATCATGG - Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1052994226 9:34541624-34541646 GTTAATGCATAGATGAATCAAGG - Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053676647 9:40437360-40437382 GTAAATGGATCAATGCAACAAGG - Intergenic
1054287073 9:63187550-63187572 GTAAATGGATCAATGCAACAAGG + Intergenic
1054289714 9:63272884-63272906 GTAAATGGATCAATGCAACAAGG - Intergenic
1054387745 9:64577424-64577446 GTAAATGGATCAATGCAACAAGG - Intergenic
1054507976 9:65938944-65938966 GTAAATGGATCAATGCAACAAGG + Intergenic
1056435090 9:86568370-86568392 GACAATGAATAAATGCATCTGGG - Intergenic
1056490206 9:87098718-87098740 GAAAATCAATAATTCCATCAAGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058027692 9:100160508-100160530 GAGAATGTATAAATGCAGGAAGG - Intronic
1058495081 9:105548572-105548594 GGAAATGCATATATTAATCAGGG + Intronic
1059945464 9:119404602-119404624 GAGACAGCATAAATACATCAAGG + Intergenic
1060570239 9:124632029-124632051 GAAAATGTACATATACATCATGG - Intronic
1060729850 9:126030372-126030394 GAAAATACAGAAAAGCATAAAGG + Intergenic
1061323267 9:129845781-129845803 GAAAATGCAGAAAAGCAAAAAGG + Intronic
1062369161 9:136228213-136228235 CTAAATGCATTAATGCACCAGGG + Intronic
1185702575 X:2242361-2242383 GAGAATGTACAAATACATCACGG + Intronic
1185814886 X:3145609-3145631 TAAAAAGCATAAAAGCATCTTGG + Intergenic
1185841179 X:3392735-3392757 GAAAATGCACATATACACCATGG + Intergenic
1186400700 X:9256822-9256844 TAAAATGCATAGATGGATGATGG + Intergenic
1186455343 X:9706276-9706298 AAAAATGCATAAAGGCTTAATGG + Intronic
1187653645 X:21442782-21442804 GAAAATGTATATATACACCATGG + Intronic
1187670591 X:21662186-21662208 GAAGATGCATGAAGGGATCAGGG - Intergenic
1187967969 X:24631561-24631583 GAGAATGCGAAAATGCTTCACGG - Intronic
1188071322 X:25721411-25721433 TACAATGAATAATTGCATCAGGG + Intergenic
1188090994 X:25965303-25965325 GAAAATGCATACAAGCACTATGG - Intergenic
1188707008 X:33347121-33347143 GAAAATGTATATATACACCATGG + Intergenic
1189503539 X:41587501-41587523 GAAAATGCAAAAATGCCTGCCGG + Intronic
1189842613 X:45096991-45097013 GAAAATGTATATATACACCATGG + Intronic
1190967465 X:55314233-55314255 GAAAATGTATAAATACACCATGG - Intergenic
1192742552 X:73907268-73907290 GAAAATGCACATATACACCATGG - Intergenic
1193410345 X:81155330-81155352 GAATGTGGAGAAATGCATCATGG + Intronic
1193638220 X:83979426-83979448 GAAAATGTATATATACACCATGG + Intergenic
1193920236 X:87415931-87415953 GAAAATGTACATATACATCATGG - Intergenic
1194078048 X:89421348-89421370 TACAATGCATAAATGCATAAGGG + Intergenic
1194416982 X:93626483-93626505 GAAATAGAATATATGCATCATGG + Intergenic
1195320523 X:103718108-103718130 GCAAATTCATAAATTCACCATGG + Intronic
1195758349 X:108221104-108221126 AAAAATGCAGAAATGCAGCCTGG + Intronic
1195981988 X:110588949-110588971 TAAAATGCACAGAAGCATCAAGG + Intergenic
1196352284 X:114745979-114746001 GTCAATGCATAAATGCTTGAGGG + Intronic
1196354375 X:114772862-114772884 GAAAATGTAAAAATGCAGAATGG - Intronic
1196694596 X:118597947-118597969 AAAAATGTTTAAATGCATAAAGG + Intronic
1197525112 X:127551642-127551664 GAAAATGCATATATACACAAAGG - Intergenic
1197631042 X:128858375-128858397 GAAACTGCAGAAATGAATGAGGG - Intergenic
1197985579 X:132263434-132263456 GAAAAATCATAAAGGCATCCAGG + Intergenic
1198558030 X:137816858-137816880 GATAATGGATAAATGGATAATGG - Intergenic
1199091359 X:143696864-143696886 GAAAATGCTGTAATGCAGCATGG - Intergenic
1199320371 X:146430977-146430999 GAAAATGCATGGAGGCATGATGG - Intergenic
1199673775 X:150167321-150167343 GCAATTGCACAGATGCATCATGG - Intergenic
1200354013 X:155528692-155528714 GAAAATGTATATATACACCATGG - Intronic
1200430694 Y:3076902-3076924 TACAATGCATAAATGCATAAGGG + Intergenic
1201228579 Y:11841817-11841839 TAAAATGCATCTATGGATCAGGG - Intergenic
1201355579 Y:13093918-13093940 GAAAATGCACAAATAAAGCAAGG + Intergenic
1201385000 Y:13430450-13430472 GGAAATGGATAAATCCCTCAAGG - Intronic
1201653042 Y:16312878-16312900 CAAAATGCATAAAAGTAACATGG + Intergenic
1202101466 Y:21312909-21312931 GAAAATGCATATTCTCATCATGG - Intergenic