ID: 1021024740

View in Genome Browser
Species Human (GRCh38)
Location 7:15650865-15650887
Sequence TGGGAGTCCCTTTTAATAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 200}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021024740_1021024746 16 Left 1021024740 7:15650865-15650887 CCTTTTATTAAAAGGGACTCCCA 0: 1
1: 0
2: 2
3: 24
4: 200
Right 1021024746 7:15650904-15650926 ATCAGGACTTGGAAACAGAGAGG 0: 1
1: 0
2: 2
3: 20
4: 284
1021024740_1021024745 5 Left 1021024740 7:15650865-15650887 CCTTTTATTAAAAGGGACTCCCA 0: 1
1: 0
2: 2
3: 24
4: 200
Right 1021024745 7:15650893-15650915 GGTAAATATGAATCAGGACTTGG No data
1021024740_1021024744 -1 Left 1021024740 7:15650865-15650887 CCTTTTATTAAAAGGGACTCCCA 0: 1
1: 0
2: 2
3: 24
4: 200
Right 1021024744 7:15650887-15650909 AGAGAAGGTAAATATGAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021024740 Original CRISPR TGGGAGTCCCTTTTAATAAA AGG (reversed) Intronic
900327455 1:2115735-2115757 TGGCTGTCCTTTCTAATAAACGG - Intronic
904639958 1:31918419-31918441 TGGGGGTGCCTTTTCATCAAAGG + Intronic
905697137 1:39983045-39983067 AGGGACGTCCTTTTAATAAAAGG - Intergenic
911694048 1:100867782-100867804 TGAGAGGCCTTTTCAATAAAAGG + Intergenic
913277102 1:117149103-117149125 TGGGGATCCCTTCTCATAAAAGG + Intronic
913657140 1:120971939-120971961 TGAAAATCCCTTTTAATAGAGGG - Intergenic
914008483 1:143755023-143755045 TGAAAATCCCTTTTAATAGAGGG - Intergenic
914521702 1:148423193-148423215 TGAAAATCCCTTTTAATAGAGGG - Intergenic
914647113 1:149663674-149663696 TGAAAATCCCTTTTAATAGAGGG - Intergenic
915650379 1:157306146-157306168 TGGGGGTACCTTTTAATTAAAGG - Intergenic
916190529 1:162173307-162173329 AGGGAATCCTATTTAATAAATGG - Intronic
919057847 1:192592863-192592885 CGTGAGTTCATTTTAATAAATGG - Intergenic
919469444 1:197960147-197960169 AGGAAATTCCTTTTAATAAAGGG + Intergenic
919555454 1:199046682-199046704 GGGGAGCCCCTTTCAATCAATGG - Intergenic
922695082 1:227727144-227727166 TGGGAGTCACTTTGCATATATGG + Intergenic
923947561 1:238905162-238905184 TAGGAATCCTTTTTAATAAATGG + Intergenic
1062851750 10:748852-748874 AAGGATTCCCTTTTAATAAATGG + Intergenic
1064678019 10:17781219-17781241 TGGGAGTGCTTTTCATTAAAAGG + Intronic
1064764435 10:18656752-18656774 TGGGATTCCAATTTAATTAAAGG + Intergenic
1068453138 10:57219474-57219496 AGGGAGTACATTCTAATAAAAGG + Intergenic
1068861012 10:61848054-61848076 TGAGAGTCCCATTGAATAAAAGG + Intergenic
1069278123 10:66618461-66618483 AAGGATTCCCTTTTAATAAATGG + Intronic
1070601547 10:77869690-77869712 TAGGAGTAACTTTTAATAAGGGG - Intronic
1070759456 10:79014646-79014668 TAGGAGTCCCATTTGACAAATGG - Intergenic
1070852293 10:79575227-79575249 AAGGATTCCCTATTAATAAATGG + Intergenic
1075756049 10:124812195-124812217 GGGGAGTCCCTGTTAGTACAGGG + Intronic
1075804925 10:125180222-125180244 AAGGATTCCCTTTTTATAAATGG - Intergenic
1078133782 11:8635680-8635702 CAGGAGTCCCTTTTAATAAGGGG + Intronic
1078268380 11:9772196-9772218 TGGGAGCTACTTTTCATAAAAGG - Intergenic
1078353440 11:10614692-10614714 AAGGAGTCCTATTTAATAAATGG + Intronic
1080200813 11:29667542-29667564 AAGGAGTCCCTATTTATAAATGG + Intergenic
1081396929 11:42597226-42597248 TGAAAATGCCTTTTAATAAATGG + Intergenic
1081561804 11:44224471-44224493 TTGGGGTCACTTATAATAAAAGG - Intronic
1082987131 11:59178740-59178762 TGGGAGAACATTTTAAGAAATGG + Intronic
1087391603 11:97541957-97541979 AAGGACTCCCTATTAATAAATGG + Intergenic
1088838992 11:113606776-113606798 TTGGATTTCCTTTTTATAAAAGG + Intergenic
1090215869 11:124963882-124963904 AAGGATTCCCTATTAATAAATGG - Intronic
1090312249 11:125751584-125751606 TGCAATTCCCTTTTAATAATCGG + Intergenic
1094382020 12:29853358-29853380 AGGGGTTCCCATTTAATAAATGG + Intergenic
1095296857 12:40536516-40536538 TGGGTTTCCCTTTTACTATAAGG - Intronic
1095352794 12:41234440-41234462 TGGAAGTCCCTTTTTATAAATGG - Intronic
1095920196 12:47521795-47521817 AAGGACTCCCTATTAATAAATGG - Intergenic
1096458222 12:51805151-51805173 TGGTAGTCCCTTTTATGAATAGG - Intronic
1097512399 12:60560234-60560256 TGAGACTCCCTCTTAAAAAAAGG - Intergenic
1099569381 12:84296434-84296456 AAGGACTCCCTTTCAATAAATGG - Intergenic
1100463876 12:94827703-94827725 AAGGATTCCCGTTTAATAAATGG + Intergenic
1100508913 12:95249256-95249278 TGGGAGTTCATTTGAAGAAAGGG + Intronic
1101260100 12:103020198-103020220 TGGGAGTTCCTTCTATCAAAAGG + Intergenic
1101524422 12:105515102-105515124 AAGGATTCCCTATTAATAAATGG - Intergenic
1103236634 12:119378401-119378423 AAGGTTTCCCTTTTAATAAAAGG - Intronic
1103398888 12:120628975-120628997 TGGTTGTGCCTTTTGATAAAAGG - Intergenic
1108989619 13:56638766-56638788 AAGGATTCCCTTTTAATAAATGG - Intergenic
1109310204 13:60684145-60684167 AGGGAGTCTCTTTTCATCAAGGG + Intergenic
1110258087 13:73454224-73454246 AAGGATTCCCTTTTAATAAATGG - Intergenic
1110414241 13:75234706-75234728 TGGAACTTCCTTTAAATAAAGGG + Intergenic
1110540919 13:76706079-76706101 TGAGTGTCCCTTTCAATAACTGG - Intergenic
1114195571 14:20473240-20473262 TGGCAGTCACTTCTAATAGACGG - Intronic
1115065159 14:29250893-29250915 AAGGATTCCCTATTAATAAATGG + Intergenic
1115339506 14:32277604-32277626 AAGGATTCCCTATTAATAAATGG + Intergenic
1116720114 14:48485236-48485258 AAGGATTCCCTATTAATAAATGG + Intergenic
1117072133 14:52067581-52067603 TGGGAGCCCCTTTGAACATAAGG - Intronic
1117458169 14:55918503-55918525 ATGCAGTCCCATTTAATAAATGG + Intergenic
1117751463 14:58928575-58928597 ATGGATTCCCTATTAATAAATGG + Intergenic
1120010582 14:79408939-79408961 TAGGAGTGCTTTTAAATAAAAGG - Intronic
1121299330 14:92857714-92857736 AAGGATTCCCTATTAATAAATGG + Intergenic
1122573493 14:102725371-102725393 TGGGAGTCCTTTTTAAAAAATGG + Intronic
1125794783 15:42396197-42396219 TGGGAGTTCCGTTTAATAATAGG - Intronic
1126104492 15:45138677-45138699 TCAGAGTCCCTTTTTATTAAGGG + Intronic
1128830582 15:70764235-70764257 TGGGAGTCATTTTTAATTGATGG - Intergenic
1128921751 15:71616983-71617005 TGGAAGTCCCTTTAAACTAATGG - Intronic
1130864637 15:87922030-87922052 TGGGAATCTCATTTAATAAGTGG - Intronic
1130873908 15:87995525-87995547 AAGGAGTTCCTATTAATAAATGG + Intronic
1130913278 15:88285386-88285408 TGGGGGTCCCATTTTAAAAATGG - Intergenic
1135977006 16:27115161-27115183 TGGGTTTCCTTTTTAATAGATGG - Intergenic
1138487368 16:57355135-57355157 GGGGAGCACCTTTTAAAAAATGG + Intergenic
1138887341 16:61095601-61095623 AAGGATTCCATTTTAATAAATGG + Intergenic
1139201784 16:64985048-64985070 TGGGATTCCCATTTAGTCAAAGG + Intronic
1139393325 16:66620208-66620230 TGAGAGTTCCTTTTAAAATAGGG - Intronic
1143875241 17:9986282-9986304 TGGGACTTCCTTTTAAAATAAGG - Intronic
1147748603 17:42711956-42711978 TGGGAGTCCCTTCTGGGAAAGGG + Intronic
1150686077 17:67321996-67322018 TGGGGGTGCTTTTTACTAAAAGG - Intergenic
1151736436 17:75943870-75943892 TGAGAGTACTTTTTAAAAAAAGG + Exonic
1152284062 17:79402435-79402457 TGGGAGCCCCATGAAATAAATGG + Intronic
1153548357 18:6234067-6234089 AAGGATTCCCATTTAATAAATGG + Intronic
1156984464 18:43332983-43333005 TGGGAGTCTTTATTAATGAATGG + Intergenic
1164002106 19:21110826-21110848 AAGGATTCCCTTTTAATAAATGG - Intronic
1164008724 19:21177268-21177290 AAGGATTCCCTTTTAATAAATGG - Intronic
1164403240 19:27918155-27918177 TATGTGTCCCTTTTAATTAATGG - Intergenic
1164470083 19:28522841-28522863 TAGAAGCCCCTCTTAATAAAAGG + Intergenic
1165473389 19:36015992-36016014 TGGGAGTATCTGTTAATAATGGG + Exonic
1168182226 19:54669684-54669706 GGGCAGTCCTTTTGAATAAATGG - Exonic
925036141 2:687595-687617 TTGGAGTCCATTTTGATGAAAGG - Intergenic
925539395 2:4950686-4950708 TTGGAGTCCCTTTTAGTCATTGG - Intergenic
926319260 2:11737135-11737157 AAGGATTCCCTATTAATAAATGG + Intronic
926923428 2:17961859-17961881 TGAGAGTCCCTATTGATATAAGG - Intronic
928886991 2:36161195-36161217 TTGGAATCACTTTTAATGAAAGG - Intergenic
929198401 2:39209801-39209823 TGGGAGTTCCTTTAAAAATAAGG + Intronic
931028553 2:58143337-58143359 TGGGCATCCCTTATAATAGAAGG - Intronic
932989385 2:76767418-76767440 TAGGATTCCCATTTAAAAAATGG + Intronic
933219052 2:79667463-79667485 TTGGAGTTCTTTTGAATAAATGG + Intronic
933433847 2:82219338-82219360 TGGGAGAATCTCTTAATAAAAGG + Intergenic
934888687 2:98047109-98047131 TAGAGGTCCCTCTTAATAAAAGG + Intergenic
935733220 2:106083771-106083793 TGGAAATCCCTTTAAATAAGGGG - Intergenic
937604009 2:123774839-123774861 TGGAAGCCTGTTTTAATAAAAGG - Intergenic
937807726 2:126165673-126165695 AAGGATTCCCATTTAATAAATGG + Intergenic
939493410 2:142902397-142902419 TAGGAGTCCATTTTACTAAATGG + Intronic
941678346 2:168368245-168368267 TCGAAGTTCCTTTTAAAAAAGGG - Intergenic
941754938 2:169174861-169174883 TGAGAGTCCCTGTTAAAAATGGG + Intronic
942827303 2:180194064-180194086 AAGGATTCCCTTTTAATAAATGG - Intergenic
944008701 2:194944455-194944477 TAGGAGGCCCTTTCTATAAAAGG + Intergenic
944105421 2:196074511-196074533 TGGAAGTCCATTTTAAAAGAAGG + Intergenic
946424669 2:219587347-219587369 TAGAAGGCCCTCTTAATAAAAGG - Intergenic
946570336 2:221017564-221017586 AGGGATTCCCTTCTAATGAATGG - Intergenic
947815440 2:233033556-233033578 TGGGGGTAGCTGTTAATAAATGG + Intronic
1172826378 20:37790635-37790657 TGGCGTTACCTTTTAATAAATGG + Intronic
1173638692 20:44583632-44583654 TGGGTGACCCTTCTAATATATGG - Intronic
1174111574 20:48201289-48201311 TGGGTGTCACTTTAAATAAAGGG + Intergenic
1175129506 20:56778994-56779016 TGGCAGTCTGTTTTAAAAAAAGG - Intergenic
1177301740 21:19255297-19255319 TAGTAGTCCATATTAATAAAAGG + Intergenic
1179411238 21:41165303-41165325 AGGGACTCCCTTCTATTAAAAGG + Intergenic
1181376251 22:22460454-22460476 TGGGGGTCGCTTTTTATTAAAGG + Intergenic
1182958045 22:34445665-34445687 TGTGAGTCACATTTAAAAAAAGG - Intergenic
950225411 3:11229521-11229543 TGAGAGTCAATTTTAATTAATGG - Intronic
951009579 3:17660805-17660827 TGGGAGTTTCTGTTATTAAAAGG + Intronic
951870690 3:27358434-27358456 TGAGAGTTTCTTTTAAAAAATGG - Intronic
952782041 3:37110823-37110845 TGGGAGTCTCTTTAAACAACGGG - Intronic
956173628 3:66453144-66453166 TGGGGGTCTCTTGTAATAATAGG - Intronic
956356301 3:68396467-68396489 TAGAAGTCCATTTAAATAAAAGG - Intronic
958041820 3:88235044-88235066 TGGGATTCCATTATATTAAATGG + Intergenic
960285909 3:115828378-115828400 TGAGAGTCCTTTTTAAAAAGTGG - Intronic
960889035 3:122426779-122426801 TGGAATACCCTTCTAATAAAAGG - Exonic
960906473 3:122606659-122606681 TGGGAGTCCGTATTTTTAAAAGG - Intronic
964244782 3:154638771-154638793 AAGGACTCCCTATTAATAAATGG + Intergenic
964483062 3:157160915-157160937 TGGGAGTCTCTATTCATACATGG + Intergenic
965588732 3:170342700-170342722 TAGAGGTCCCTCTTAATAAAAGG - Intergenic
965612263 3:170556958-170556980 TGGGAGTCTCATTTAAAAAGTGG + Intronic
967128290 3:186446486-186446508 TTGGAGTTTCTTTTACTAAAGGG + Intergenic
967339545 3:188381082-188381104 ATGGAGTCTCCTTTAATAAATGG + Intronic
970054910 4:11960499-11960521 AAGGATTCTCTTTTAATAAATGG - Intergenic
970070703 4:12156400-12156422 ATGGATTCACTTTTAATAAATGG - Intergenic
971536289 4:27755443-27755465 GAGGAGTCCCTTTTAATGAGTGG + Intergenic
973031351 4:45345213-45345235 TCAGAGTTGCTTTTAATAAATGG + Intergenic
973814589 4:54607461-54607483 TGGGAGTCATTTTTGAAAAAGGG - Intergenic
974400578 4:61400517-61400539 TGGGATTCCCTGTGAATAACTGG + Intronic
974648115 4:64719425-64719447 TGGGGGTCGCTTTTTATAAATGG + Intergenic
974691716 4:65305517-65305539 TGGGATTCCCTCTTACTAGAAGG - Intergenic
974734049 4:65905601-65905623 AAGGATTCCCTATTAATAAATGG - Intergenic
975289095 4:72656040-72656062 AAGGATTCCCATTTAATAAATGG + Intergenic
976171225 4:82306847-82306869 TGGAAGTCTCTTTTAATCTATGG - Intergenic
976433652 4:84992145-84992167 AACGATTCCCTTTTAATAAATGG + Intergenic
976652995 4:87456182-87456204 TAGGACTCCTGTTTAATAAAAGG - Intronic
978483142 4:109217697-109217719 TTTGAGTCCCTTATATTAAATGG + Intronic
980224448 4:129963311-129963333 GGGGTGTCCTATTTAATAAATGG - Intergenic
981244071 4:142513707-142513729 TGGGGGTCTCTTTTATAAAAGGG + Intronic
981822318 4:148900301-148900323 TGGGAGTCCTTTCTAACAAAGGG - Intergenic
983528517 4:168785208-168785230 TGGGATTCCATTTTAACAAGGGG + Intronic
984008215 4:174339063-174339085 TTGGAGTCTTTTTTAAAAAATGG + Intergenic
987670118 5:20995884-20995906 AAGGAGTGCCTATTAATAAATGG + Intergenic
987687163 5:21219649-21219671 TGTAAGCCCCTTTTAGTAAATGG - Intergenic
991946737 5:71905406-71905428 AGGAAGTACCATTTAATAAATGG - Intergenic
992026563 5:72675554-72675576 AAGGATTCCCTATTAATAAATGG - Intergenic
993289542 5:86047645-86047667 TGGTAATCTCTTTTATTAAATGG + Intergenic
994109049 5:95980301-95980323 TGAAAGTCTCCTTTAATAAAAGG + Intergenic
994918716 5:106013387-106013409 TGGAAGCCCATTTTAGTAAAAGG - Intergenic
995832498 5:116369435-116369457 TGGGAGTCCATTTTCACAAGGGG + Intronic
995923842 5:117344866-117344888 TGGAAGTCTTTTTTAAGAAAAGG - Intergenic
996361534 5:122653143-122653165 GGGGACTCCCTTTAAAGAAAAGG - Intergenic
997154458 5:131538576-131538598 TTCGAGTCCCTTTTATAAAATGG - Intronic
997250409 5:132384604-132384626 TGGCAGGCCCTTTTTGTAAATGG - Intronic
997876151 5:137549273-137549295 AGGGAATCCTATTTAATAAATGG + Intronic
1000480616 5:161768998-161769020 AAGGATTCCCTATTAATAAATGG + Intergenic
1001354995 5:171010876-171010898 TGGGTTTACATTTTAATAAAAGG + Intronic
1003266768 6:4572629-4572651 AAGGATTCCCTATTAATAAATGG - Intergenic
1005323222 6:24675964-24675986 AAGGATTCCCTTTTAATAAATGG - Intronic
1006047566 6:31309849-31309871 GGGGCCTCCCTTTTAGTAAAGGG + Intronic
1006864740 6:37200304-37200326 GGGGAGTCCCCTTCAAGAAATGG + Intergenic
1009328436 6:62383681-62383703 AAGGATTCCCTATTAATAAATGG - Intergenic
1010697575 6:78995782-78995804 TTGGATTCCATTTTAATTAATGG + Intronic
1014200899 6:118607636-118607658 TTGGAGCCCCTCTTAATAAAAGG - Intronic
1014817345 6:125950653-125950675 TGTGAGCCCTTTTTAGTAAATGG - Intergenic
1018077231 6:160228394-160228416 TAAAAGTCCCTCTTAATAAAAGG + Intronic
1020072629 7:5237517-5237539 GGGGAGTTCCTTTTCATCAAAGG + Intergenic
1021024740 7:15650865-15650887 TGGGAGTCCCTTTTAATAAAAGG - Intronic
1021398622 7:20182768-20182790 TGGGAGTCACTTTTCATATATGG + Intronic
1023324259 7:39035620-39035642 TGGGATTCCCAGTTATTAAAGGG + Intronic
1024572881 7:50738854-50738876 TAGTAGGCCCTTTTAATCAAGGG - Intronic
1024770134 7:52712871-52712893 TGGGACTGCTTTTTATTAAAAGG - Intergenic
1024770355 7:52714615-52714637 TGGGACTGCTTTTTATTAAAAGG - Intergenic
1026137280 7:67674476-67674498 TGGGAATCCCTCCTAATAAGTGG + Intergenic
1027881223 7:83840085-83840107 GGTGACTCCCTTTTAATAATAGG + Intergenic
1028145431 7:87315213-87315235 TGAGAGACCCCTTTTATAAAAGG - Intergenic
1028485256 7:91350442-91350464 TGAAAGTCCCTTTTAACTAAAGG - Intergenic
1032690338 7:134279806-134279828 TGGGCTTCCATTTTAATAAGAGG - Intergenic
1038057185 8:23871509-23871531 TGGCAGTCCCTTATAACAAAAGG + Intergenic
1042106573 8:65333689-65333711 GGGGTGACCCTTTTATTAAATGG + Intergenic
1042465724 8:69128528-69128550 AAGGATTCCCTATTAATAAACGG + Intergenic
1042815008 8:72868635-72868657 TTGGAGTTGCTTTTAATAATGGG - Intronic
1043946300 8:86257240-86257262 AGGGAGTCCCTTTGACAAAAGGG - Intronic
1044315402 8:90744821-90744843 AAGGATTCCCTATTAATAAATGG - Intronic
1048579250 8:135717786-135717808 TGTGTGTGTCTTTTAATAAAGGG - Intergenic
1050003453 9:1102658-1102680 TTGGAGTCCCCTTTAAGAGATGG + Intergenic
1051327947 9:15993345-15993367 AAGGATTCCCTATTAATAAATGG + Intronic
1051329370 9:16007672-16007694 AAGGATTCCCTATTAATAAATGG - Intronic
1051660046 9:19417617-19417639 AAGGATTCCCTATTAATAAATGG + Intronic
1051723293 9:20062392-20062414 AAGGATTCCCTATTAATAAATGG + Intergenic
1051862923 9:21647043-21647065 AAGGATTCCCTATTAATAAATGG - Intergenic
1053654513 9:40202711-40202733 TGTGAGTACCTTTTAATTAAGGG + Intergenic
1054366628 9:64348928-64348950 TGTGAGTACCTTTTAATTAAGGG + Intergenic
1054530081 9:66173600-66173622 TGTGAGTACCTTTTAATTAAGGG - Intergenic
1054674257 9:67838670-67838692 TGTGAGTACCTTTTAATTAAGGG + Intergenic
1058354111 9:104062505-104062527 AAGGATTCCCTATTAATAAATGG + Intergenic
1059943026 9:119376334-119376356 TAGGAGTACTTTTTAATAATGGG - Intergenic
1059989503 9:119851828-119851850 TGAGAGTCCATTTTAAAAAGTGG + Intergenic
1060148223 9:121269471-121269493 TGGGTGTTCCGTTTACTAAAGGG + Intronic
1061467733 9:130795879-130795901 TGAGAGTGCCTTTTAAAAATAGG + Intronic
1186080933 X:5930981-5931003 TGAGAGTCCCTTATGATAAGTGG - Intronic
1186133905 X:6498309-6498331 TGGGAGTCACTTATAGCAAAAGG - Intergenic
1187972034 X:24668450-24668472 TCGGAGTCCACTTCAATAAATGG + Intronic
1189592597 X:42530836-42530858 TGGGGTCCCCTTTTAATATAGGG + Intergenic
1192851659 X:74962863-74962885 TGTGACTCATTTTTAATAAAAGG - Intergenic
1193384953 X:80858756-80858778 AAGGATTCCCTATTAATAAATGG - Intergenic
1194307995 X:92272229-92272251 TCAGAGTCCTTTTTCATAAATGG - Intronic
1195605451 X:106801458-106801480 TGGGATTCTCTTCTACTAAATGG - Intergenic
1199293310 X:146129485-146129507 TGGGAGCCCCTTCTAATACTGGG + Intergenic
1200889389 Y:8306933-8306955 AAGGATTCCCTATTAATAAATGG - Intergenic
1201380818 Y:13376746-13376768 AGTGGATCCCTTTTAATAAACGG + Intronic
1202033390 Y:20604066-20604088 AAGAAGTCCCATTTAATAAATGG + Intergenic