ID: 1021025990

View in Genome Browser
Species Human (GRCh38)
Location 7:15667417-15667439
Sequence ATGGTGACAATCTGTGACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 126}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021025990_1021025991 -7 Left 1021025990 7:15667417-15667439 CCTCTGTCACAGATTGTCACCAT 0: 1
1: 0
2: 2
3: 10
4: 126
Right 1021025991 7:15667433-15667455 TCACCATTTGTTTCCATCTTTGG 0: 1
1: 0
2: 1
3: 25
4: 276
1021025990_1021025994 12 Left 1021025990 7:15667417-15667439 CCTCTGTCACAGATTGTCACCAT 0: 1
1: 0
2: 2
3: 10
4: 126
Right 1021025994 7:15667452-15667474 TTGGCTTCCCTATTGTACTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021025990 Original CRISPR ATGGTGACAATCTGTGACAG AGG (reversed) Intronic
901053849 1:6439656-6439678 ATGGTGACAGTGGGTGAGAGGGG + Intronic
901921599 1:12541088-12541110 CTGGTGACAATTCCTGACAGCGG - Intergenic
905314617 1:37074034-37074056 ATGGTGACATGCAGTGACAAGGG + Intergenic
910864670 1:91777249-91777271 ATTGTGACAGCCTGTGACACTGG - Intronic
913745567 1:121899939-121899961 ATGTTGACATTCACTGACAGAGG - Intergenic
916239418 1:162624021-162624043 TAGGTGGCAATCTGTGCCAGAGG + Intergenic
917789697 1:178491729-178491751 ATGGAGAAGATCTATGACAGAGG - Intergenic
920077322 1:203346976-203346998 ATGGAGACATTCTGGGACAGAGG - Intronic
921709510 1:218359502-218359524 ATGGTGATATTTTCTGACAGTGG - Intronic
923679891 1:236110871-236110893 ATGGCGACAATCTGCAACATGGG + Intergenic
924620174 1:245653507-245653529 ATTCTGACAACCTGTGACATAGG + Intronic
1066433860 10:35378924-35378946 TTGGTGAGAAGCTGAGACAGAGG + Intronic
1069990265 10:72310858-72310880 TTGGTGGAAATCTGTGAGAGGGG + Intergenic
1070690993 10:78525360-78525382 ATGGTTACAAAGTCTGACAGAGG + Intergenic
1071150233 10:82625786-82625808 ATGGTCACAATATGTGTAAGTGG + Intronic
1071381105 10:85061077-85061099 CTGGTGACTAGCTTTGACAGAGG - Intergenic
1071415872 10:85440965-85440987 ATGGTCACATTCTGAGACATTGG - Intergenic
1080949161 11:37008865-37008887 ATGGTGATAAGCAGGGACAGAGG - Intergenic
1089203082 11:116736916-116736938 AGCGTGACAACCTGTGCCAGAGG - Intergenic
1091396728 12:157778-157800 CAGGTGACCATCTGTGATAGGGG - Intronic
1091781927 12:3219344-3219366 ATGGTGACAAACTAAGGCAGTGG - Intronic
1091882571 12:3991307-3991329 ACGTTGACAATGTGTGACAGAGG + Intergenic
1098273854 12:68794269-68794291 ATGGTCACATTCTGAGATAGAGG + Intergenic
1099496911 12:83359570-83359592 ATGGTGAAATCATGTGACAGTGG + Intergenic
1101567417 12:105921240-105921262 ATGGTCCCAATCTGTGAAATGGG - Intergenic
1102200572 12:111055290-111055312 ATGGTGACCAGCTCTGACGGTGG - Intronic
1102414507 12:112748803-112748825 ATGTTGACACACTGTGCCAGAGG + Intronic
1107341423 13:39411001-39411023 TTAGTGACAATCTCTGTCAGAGG + Intronic
1111308267 13:86445673-86445695 ATGGTGAAAATGGGTGAGAGAGG + Intergenic
1111446452 13:88350946-88350968 ATGGTGAAAAAATGTAACAGAGG - Intergenic
1114867299 14:26612081-26612103 TTGTTGACTATCTGTGACATTGG + Intergenic
1115425046 14:33248697-33248719 ATGGTGACAACCAATCACAGTGG - Intronic
1119625067 14:76166810-76166832 ATGGTGACTGTCTATGGCAGTGG + Intronic
1120501923 14:85308116-85308138 GTGATGACTATGTGTGACAGAGG + Intergenic
1122768660 14:104087289-104087311 ATTGTGTCACTCTGTGTCAGTGG - Intronic
1126183505 15:45809104-45809126 AGGGTGATAAACTGTGACAGTGG - Intergenic
1128442465 15:67724868-67724890 GTGGTGACACTCTGTAAGAGAGG + Intronic
1129044199 15:72719164-72719186 ATGGTGACCATTTGTGGCACTGG - Intronic
1129164187 15:73766969-73766991 ATGGTGAGAAGATGTGACAGTGG + Intergenic
1130067887 15:80620232-80620254 ATGGTGACAAGCTACAACAGAGG + Intergenic
1134296818 16:12953670-12953692 ATTGTGTCAGTCTGAGACAGTGG + Intronic
1140772322 16:78216377-78216399 CTGGTGATAATGTGTTACAGCGG - Intronic
1141862723 16:86728992-86729014 TTTGTGACAATTTGTTACAGCGG - Intergenic
1142503071 17:344789-344811 ATGGTGACAATGTCTGATGGAGG - Intronic
1144460617 17:15455865-15455887 ATGGAGAGACTCTGAGACAGAGG + Intronic
1152771027 17:82169442-82169464 TTTGAGACAATCTGTGCCAGTGG + Intronic
1156845153 18:41657335-41657357 ATTGTGTCAGTCTGTGTCAGAGG + Intergenic
1159513338 18:69425288-69425310 ACTGTGACAAGCTGTGATAGTGG - Intronic
1163693131 19:18748272-18748294 ATGGTCACACTCTGTTACTGAGG + Intronic
1165009419 19:32833047-32833069 AGGGTGAGACACTGTGACAGAGG + Intronic
1165009960 19:32838019-32838041 AGGGTGAGACACTGTGACAGAGG + Intronic
1165012304 19:32857897-32857919 GAGTTGAGAATCTGTGACAGAGG + Intronic
1165781695 19:38438411-38438433 ATGGTCTCAATCTGTCTCAGGGG + Intronic
934160421 2:89244389-89244411 ATAGTCACAATCTGTGTCAATGG + Intergenic
934206854 2:89938049-89938071 ATAGTCACAATCTGTGTCAATGG - Intergenic
934692656 2:96373567-96373589 ATGGTGACCATCTAGGAGAGGGG + Exonic
935246579 2:101224096-101224118 ATGGTGCCAAGCCTTGACAGTGG + Intronic
935598828 2:104901518-104901540 ATGGTGACATGCTGTCACCGTGG - Intergenic
943703248 2:191009343-191009365 ATGGTGACTATCTCTGAAGGGGG + Intronic
944297843 2:198087328-198087350 ATGCTTATAATCTGAGACAGTGG + Intronic
945579250 2:211572346-211572368 ACGCTAACAATCTGTGACATTGG + Intronic
945837574 2:214850911-214850933 ATTCTTACAATCTGTGTCAGTGG + Intergenic
946106293 2:217372859-217372881 GTGGTGAGTATCTGAGACAGAGG + Intronic
947166152 2:227264256-227264278 CTGGAGACTATCTGTGCCAGGGG + Intronic
1169870763 20:10245861-10245883 ATGGTGACAAGATGGGACAAAGG - Intronic
1170077965 20:12440512-12440534 ATGGTGTCAATCTAAGAAAGAGG + Intergenic
1170815344 20:19709139-19709161 ATGGAGTCATTCTGAGACAGAGG - Intronic
1171531958 20:25858959-25858981 ATGGTGAGAATGTGTGTCACCGG + Intronic
1173580978 20:44146324-44146346 ATGGTGACCATGTGGGCCAGGGG - Intronic
1178978516 21:37241423-37241445 ATGGTCTCAATCTGTTACAGGGG + Intronic
1179180868 21:39043833-39043855 ATAGTGAGAGTCTCTGACAGTGG - Intergenic
1179291433 21:40021308-40021330 ATGGTAACCATCTGGGACAGTGG + Intronic
1179608585 21:42534099-42534121 AGGGGGACAATGTGGGACAGGGG - Intronic
1181156165 22:20922486-20922508 ATGGTGACTAATAGTGACAGTGG + Intronic
1182972387 22:34590424-34590446 ATGGTGACAGTCTGCAACATGGG - Intergenic
1183837984 22:40472718-40472740 GTGTTGATAATTTGTGACAGTGG - Intronic
1183976898 22:41517529-41517551 ATGGCGACAATCTGCAACATGGG + Exonic
1184468138 22:44680822-44680844 GTGGTGGCAGTGTGTGACAGAGG + Intronic
949873634 3:8609742-8609764 ATAATGACAATATGTGACATTGG + Intergenic
950762023 3:15239220-15239242 ATGGTGACAAATTGTGGCTGGGG - Intronic
952313998 3:32216674-32216696 ATGATGACAATGTGTCAAAGGGG + Intergenic
953682365 3:45049374-45049396 ATGCTGGCAATCTGTGAGATAGG - Intergenic
956204526 3:66741629-66741651 ATGGTAAAAATCTGTGACAGGGG + Intergenic
960066790 3:113382907-113382929 ATGGTCACCATGTGTGAAAGAGG + Intronic
960221801 3:115120773-115120795 ATGGTGCCAATCTGTTACAGTGG - Intronic
966814563 3:183879505-183879527 CTGGTGACAATTTGAGACACTGG + Intronic
967941755 3:194771810-194771832 CTGGTGATTATCTGAGACAGTGG + Intergenic
972091233 4:35287235-35287257 TTGGTGAAAATATGTAACAGTGG - Intergenic
972523276 4:39882902-39882924 ATGGTGAAGATTTGTAACAGTGG - Intronic
972841807 4:42939731-42939753 ATGGTGGCAATATGTGGGAGAGG + Intronic
974389399 4:61245972-61245994 ATGCTAACAAACTGTGGCAGGGG - Intronic
976690031 4:87859009-87859031 ATGGTGACAATCTAGGCAAGAGG + Intergenic
979192216 4:117875927-117875949 ATGGTGACAGCCTGTACCAGAGG + Intergenic
979456064 4:120927377-120927399 ATGGTGACCATTTGTTAAAGAGG + Intergenic
984204851 4:176774538-176774560 ATGGGGACAACATGTGAAAGAGG + Intronic
985999727 5:3620873-3620895 ATGGTCACTATCAATGACAGAGG - Intergenic
988728400 5:33946226-33946248 TTGGTGACAATGTTTGCCAGGGG + Intronic
991219458 5:64195869-64195891 ATGGTGCCAATCTGAGATGGTGG - Intronic
991499444 5:67262463-67262485 ATGGTGACACTCTTTGACACAGG - Intergenic
993047247 5:82881301-82881323 ATGGTGCTCATCTGTGCCAGTGG + Intergenic
994010858 5:94900424-94900446 TTGGTGACAATGCTTGACAGTGG + Intronic
996881778 5:128305596-128305618 ATGGTGATAATCTCTGCCAGCGG - Exonic
1003082914 6:3036909-3036931 GTGGTGACTATCTGGGCCAGTGG - Intergenic
1003188743 6:3854768-3854790 CTGGGGTCCATCTGTGACAGAGG - Intergenic
1004235696 6:13872977-13872999 ATGGTGACATTCTGAGATACAGG - Intergenic
1005564620 6:27078549-27078571 ATGGTGAGAATCTGTCAAATAGG - Intergenic
1006486897 6:34350127-34350149 ATGGTGATAATCTATGCCATAGG + Intronic
1009833421 6:68967998-68968020 CTGGTGGGAAGCTGTGACAGTGG + Intronic
1011911863 6:92450185-92450207 ATGGTGAAAGTATGTGACACTGG + Intergenic
1012990351 6:105919642-105919664 ATGGTGAAGATCTGGGAAAGTGG - Intergenic
1013482852 6:110567019-110567041 ATAGAGAGAATCTGTGACACTGG + Intergenic
1013755783 6:113460010-113460032 ATGGTGAGAATCTATTGCAGGGG - Intergenic
1014255975 6:119160190-119160212 ATGGGGAGAATCTGAGATAGAGG - Intergenic
1015166083 6:130201627-130201649 ATGGTGAGATTCTGTTAGAGAGG - Intronic
1015895484 6:138012574-138012596 ATGGTGTCAATCTGTCACCCAGG - Intergenic
1019857243 7:3621498-3621520 ATGTGGACAGTGTGTGACAGTGG + Intronic
1020802602 7:12749971-12749993 ATGGTGACTCTCTGCAACAGAGG + Intergenic
1021025990 7:15667417-15667439 ATGGTGACAATCTGTGACAGAGG - Intronic
1022812534 7:33884162-33884184 ATAGAGATAATCTGTGCCAGTGG - Intergenic
1029986527 7:104928037-104928059 ATGGTTACATTCTGAGATAGTGG - Intergenic
1031668502 7:124515088-124515110 ATGATGAAAATCTGTGGCAAAGG - Intergenic
1032633739 7:133682995-133683017 ATGTTGTCATTCTGTGAAAGGGG + Intronic
1033956256 7:146852099-146852121 ATGGTAACATTCTGAGACATTGG + Intronic
1037786139 8:21904336-21904358 ATGGTGTAAGCCTGTGACAGTGG - Intergenic
1039027318 8:33271810-33271832 ATGGTGACAGTCAGGGGCAGGGG - Intergenic
1039810178 8:41040373-41040395 ATGAAGACAATTGGTGACAGTGG + Intergenic
1041545264 8:59035118-59035140 ATGGTAACATTCTGTGAAAGTGG - Intronic
1044122889 8:88419536-88419558 ATTCTGACAATCTGAGACAATGG + Intergenic
1048598105 8:135888331-135888353 ATGTTGCCAAAGTGTGACAGGGG - Intergenic
1049512404 8:143035756-143035778 ATGGTGACATTCTTTGTCTGGGG - Intergenic
1050060380 9:1703040-1703062 ATGGGGAAAATCTGTGATAGAGG + Intergenic
1056331852 9:85527879-85527901 ATGCTGACAAGCTGTTCCAGGGG + Intergenic
1056446726 9:86673629-86673651 ATGGTGACAGGCTATGACACAGG + Intergenic
1058372692 9:104288219-104288241 GTAGAGACAATCTGTGACATAGG + Intergenic
1189246425 X:39566871-39566893 ATGGTGACATTCTGAGGCACTGG - Intergenic
1197802596 X:130367374-130367396 GTGGTGACATTCATTGACAGAGG + Intronic
1198486576 X:137093347-137093369 ATGGTGAAAAAATGTAACAGTGG + Intergenic
1201349608 Y:13024659-13024681 ATGGTGTCACTCTGTGGAAGTGG + Intergenic
1202099620 Y:21293528-21293550 ATGGCGAGAATCTGACACAGAGG + Intergenic