ID: 1021027771

View in Genome Browser
Species Human (GRCh38)
Location 7:15689084-15689106
Sequence TAAGAAGAAGTGGCAGCCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 204}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021027771_1021027774 0 Left 1021027771 7:15689084-15689106 CCCGAGGCTGCCACTTCTTCTTA 0: 1
1: 0
2: 0
3: 17
4: 204
Right 1021027774 7:15689107-15689129 AACCTGCCCAGTGACTGTGCTGG 0: 1
1: 0
2: 4
3: 19
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021027771 Original CRISPR TAAGAAGAAGTGGCAGCCTC GGG (reversed) Intergenic
900616816 1:3569209-3569231 AAAGAAGCAGGGACAGCCTCTGG + Intronic
900933044 1:5748539-5748561 GAAGACCAAGTGGGAGCCTCTGG + Intergenic
902359161 1:15932688-15932710 AAAGAAGACGTGTCTGCCTCTGG + Exonic
905493504 1:38364001-38364023 TAAAAGGAAGAAGCAGCCTCAGG + Intergenic
908942438 1:69451660-69451682 TAAGAAGCTGTGCCAACCTCTGG - Intergenic
910153500 1:84185161-84185183 TAAGAAGAATTGGAAGGTTCAGG + Exonic
911421034 1:97641021-97641043 TAAGAAAAACTGGGAGCCTATGG - Intronic
911643628 1:100315779-100315801 TAAGAAGTAGTGGCAGGACCAGG - Intergenic
914877062 1:151520058-151520080 GGAGGAGAAGTGGCAGTCTCAGG - Intronic
915298210 1:154936708-154936730 TAGGGAGAAGTGTCAGCTTCAGG - Exonic
915457648 1:156051295-156051317 GAAGAAGCAGTGGCAGCAGCTGG + Exonic
915580238 1:156809011-156809033 GGAGAAGAGGGGGCAGCCTCTGG + Intronic
915597260 1:156902698-156902720 TAAGCAGATGTGGGCGCCTCGGG + Intronic
916854615 1:168737021-168737043 TAAAAAAAAATGGCAGCTTCCGG - Intergenic
917063536 1:171066871-171066893 TAAGTAGGAGTTGAAGCCTCTGG - Intergenic
920833342 1:209485133-209485155 TAATAAGAAGTGGCAGCGACTGG + Intergenic
922116866 1:222621710-222621732 TATGAAAAAGTGGCAGTCTTGGG + Intronic
922400820 1:225253384-225253406 TTAGAGGAAGTGGCAGCCAGAGG - Intronic
922590671 1:226773492-226773514 TAATCAGAGGTGGAAGCCTCAGG + Intergenic
922814740 1:228440427-228440449 TCTGAAGTAGAGGCAGCCTCGGG + Intergenic
1065233493 10:23622564-23622586 CAAGAAGATGAGGCTGCCTCTGG + Intergenic
1065603520 10:27393227-27393249 TCCTCAGAAGTGGCAGCCTCAGG - Intergenic
1065867540 10:29926959-29926981 TAAGCATCAGTGGCAGCCTAAGG - Intergenic
1069767326 10:70872568-70872590 GAAGAAGTATTAGCAGCCTCAGG + Intronic
1070162875 10:73876299-73876321 CAAGACTGAGTGGCAGCCTCTGG - Intergenic
1071232350 10:83603136-83603158 TCATAAGAAGTGGGAGCCTTTGG - Intergenic
1075478470 10:122757199-122757221 TATGATGAAGTGACAGCTTCAGG - Intergenic
1075779864 10:125010374-125010396 TAAAATGAAATCGCAGCCTCTGG - Intronic
1076138820 10:128063902-128063924 AAAGAAGAACTGGGAGCCTGAGG + Intronic
1076475656 10:130749960-130749982 TCAGAACAAGTGGGGGCCTCAGG - Intergenic
1076781943 10:132729258-132729280 GGAGAAGATGTGGCAGACTCAGG - Intronic
1078897026 11:15605870-15605892 TCAGCAGAAGTTGCTGCCTCTGG + Intergenic
1081295936 11:41389386-41389408 TAAAAAGAAGTGGAAGAATCTGG + Intronic
1083860437 11:65417479-65417501 CAAGAGGAAGTGGTAGGCTCTGG + Intergenic
1084766330 11:71311351-71311373 TAAGTGGAAATGGCATCCTCCGG + Intergenic
1086500288 11:87445797-87445819 GGAAAAGAAGTGGCAGACTCTGG + Intergenic
1088172576 11:107016119-107016141 TAAGAAGGAGTGGAACCCTGAGG - Intronic
1089396002 11:118136589-118136611 TAGGAAGAAGTGGCTTCCTTTGG - Exonic
1089556801 11:119319620-119319642 TAAGGAGAAGTGGAACCCTGGGG + Intronic
1090409251 11:126496482-126496504 TGAGAAGAAATGGCAGCCATGGG - Intronic
1090471181 11:126982581-126982603 AAAGGAGAAGTGGCAGCTCCAGG - Intronic
1094297840 12:28927873-28927895 TCAGGAGAAGAGGCAGCCTTTGG + Intergenic
1094486218 12:30927598-30927620 TGAGGAGAAGAGGCAGCTTCTGG + Intronic
1099499447 12:83394813-83394835 AAAGTAGAAGTGGGATCCTCAGG + Intergenic
1100042151 12:90333038-90333060 TATGAATTAGTGGAAGCCTCAGG + Intergenic
1100373013 12:93986399-93986421 TAATCAGAAGTGGAAGACTCAGG - Intergenic
1104995134 12:132649464-132649486 CAAGAAGAAGTGGCAGCTGCAGG - Exonic
1105795523 13:23848618-23848640 TACAAAGAAGAGGCAGCATCTGG + Intronic
1105882576 13:24616880-24616902 TAAGAAGGAGTGGGAGCAACTGG - Intergenic
1106005468 13:25766029-25766051 TAAGGAGGAGTCGCAGCCTCAGG + Intronic
1106206233 13:27598047-27598069 TCAGCAGGAGTTGCAGCCTCAGG + Intronic
1106662335 13:31812926-31812948 TGAGAAGAAATGGTAGCATCAGG - Intergenic
1106931524 13:34670798-34670820 ACAGAAGAAGTAGCAGTCTCTGG - Intergenic
1107911367 13:45108614-45108636 TAACAAGAAGTGGGGGCTTCTGG - Intergenic
1109789823 13:67231116-67231138 AAAGAGAAAGTGGCAGCGTCTGG + Intergenic
1110875423 13:80503783-80503805 TAAGAAGCAGTGACACCCCCTGG - Intergenic
1113605515 13:111602331-111602353 GAAGAAGATGTGGCAGCCGCAGG - Intronic
1114341632 14:21751429-21751451 TAAGAAGCAGAAGAAGCCTCTGG + Intergenic
1115764538 14:36609586-36609608 TAAGAAAATGTGGTAACCTCTGG + Intergenic
1117050090 14:51851070-51851092 TTATAAGAAAAGGCAGCCTCAGG + Intronic
1117792223 14:59353172-59353194 TACGAAGCTGTGGCTGCCTCAGG - Intronic
1122357301 14:101131422-101131444 AATGAATAAGTGACAGCCTCTGG + Intergenic
1125355849 15:38816813-38816835 TAAGAAGTGAAGGCAGCCTCTGG + Intergenic
1126339153 15:47620491-47620513 TAAGATGAACATGCAGCCTCTGG + Intronic
1126452777 15:48827556-48827578 TAAAAAGTAGTGACAGCCTGAGG - Intronic
1127394328 15:58531575-58531597 AAAGAAGAAGTTGTGGCCTCAGG + Intronic
1128064616 15:64756587-64756609 AAAGATGAAGTGGCTTCCTCAGG - Intronic
1128293773 15:66499502-66499524 TAAGAAGCAGAAGAAGCCTCTGG - Exonic
1132400843 15:101504186-101504208 TAAAAAGAAGTGGCAGGCACAGG + Intronic
1132507108 16:316496-316518 TAGAAGGAAGGGGCAGCCTCAGG - Intronic
1133126932 16:3653150-3653172 TAAGAAGAAGAGGCAGAGACTGG + Intronic
1134229897 16:12420746-12420768 TGAGATGAAGAGGCAGCCTCAGG + Intronic
1134869754 16:17641216-17641238 GAACAAGATGTGACAGCCTCAGG + Intergenic
1135565424 16:23508031-23508053 TAAGAGAAAGTAGCTGCCTCAGG - Intronic
1136142373 16:28295764-28295786 TCAGATGATGTGGCAACCTCAGG + Intronic
1136657700 16:31720815-31720837 TAAAGAGAAATGGCAGTCTCTGG - Intronic
1137267444 16:46880820-46880842 TAAGAAAAAATGGAAGCCTCTGG - Intergenic
1141244549 16:82293840-82293862 AGAGAAAAAATGGCAGCCTCAGG - Intergenic
1142524809 17:532552-532574 TAAGAAGAAGTGGCTGGGCCGGG - Intronic
1145751525 17:27358340-27358362 TTAGAAGAAGGGTCAGCCTTAGG - Intergenic
1146501157 17:33365654-33365676 GAAGAAGAAGTGACATCCCCAGG - Intronic
1148212197 17:45815292-45815314 GAGAAAGAAGGGGCAGCCTCAGG + Intronic
1150501845 17:65658674-65658696 GAAGAAGAAGCTGTAGCCTCGGG + Intronic
1150938709 17:69666421-69666443 TAAGAAAACCAGGCAGCCTCTGG + Intergenic
1151430524 17:74059509-74059531 TAAGAAGAAGTGGGAGGCTGTGG + Intergenic
1153311397 18:3680337-3680359 GAAGGAGCAGTGGCAGCCACAGG + Intronic
1154022745 18:10678917-10678939 AAAAAAGAAATTGCAGCCTCTGG - Intronic
1156512871 18:37655742-37655764 GAAGGAGAAGGGGAAGCCTCTGG - Intergenic
1158751349 18:60265012-60265034 TTAGACAAAGTGCCAGCCTCAGG + Intergenic
1159429616 18:68334792-68334814 TAGGGAGAAATGGCAGCCTGTGG + Intergenic
1160152931 18:76408451-76408473 TAAGAAGAAGTGCATGGCTCTGG + Intronic
1161473194 19:4471598-4471620 TTAGAGGAAGGGGCAGGCTCCGG - Intergenic
1161812932 19:6481162-6481184 CAAGCAGAAGAGGCAGCCTTGGG + Intronic
1161872530 19:6881446-6881468 TAGGAAAAAGTGCAAGCCTCTGG - Intergenic
1163920015 19:20279612-20279634 TGAGAAGAGGGGCCAGCCTCAGG + Intergenic
1164655113 19:29915386-29915408 AAAAAAGAAGGAGCAGCCTCAGG + Intergenic
927129133 2:20042571-20042593 TAATGGGAAGGGGCAGCCTCTGG - Intronic
927155487 2:20219007-20219029 GAGGAACCAGTGGCAGCCTCGGG + Intronic
927251900 2:21003228-21003250 TGGGAAGAAGAGGCAGCTTCTGG - Exonic
929991872 2:46797068-46797090 TCAGAACATGGGGCAGCCTCAGG + Intergenic
932283623 2:70515136-70515158 TGGGAAGAAGTGGAAGGCTCTGG - Intronic
934307948 2:91841626-91841648 TAAGAAGAAGTGGCTCCCACAGG + Intergenic
934476394 2:94596373-94596395 GAAAAAGAAGGGGCAGCCTCTGG + Intronic
938039286 2:128062579-128062601 GAAAATGAAGAGGCAGCCTCAGG - Intergenic
938662927 2:133505810-133505832 GAAGTAGCAGTGGCAGCCTCAGG - Intronic
940045090 2:149401377-149401399 TAAGCAGAAGTGCCAGGCACAGG + Intronic
940313246 2:152301478-152301500 CAAGAAGAAGTGGCAGAATTAGG - Intergenic
944193579 2:197028805-197028827 TAAGAAGCAGAGGAAACCTCTGG - Intronic
944776515 2:202972381-202972403 TAAGAGGCAGTGGCAGAGTCAGG + Intronic
946767804 2:223056197-223056219 TATGAAGAAGAGGCTGCCGCAGG - Intronic
948814563 2:240503137-240503159 TAAGAGGAAGGGGCGGCCTGAGG + Intronic
1169445664 20:5669241-5669263 CAAGAAGCACTGCCAGCCTCTGG - Intergenic
1169966261 20:11221013-11221035 TAAGAGGAAGTACAAGCCTCTGG + Intergenic
1170635306 20:18099224-18099246 GAAAAAGGTGTGGCAGCCTCAGG - Intergenic
1170648310 20:18216174-18216196 TCAGGAGAAGGGGCAGTCTCTGG - Intergenic
1170679799 20:18516146-18516168 TAAGAAGGAGTGGCTGGCCCAGG - Intronic
1173905876 20:46628353-46628375 GAAGAAGGAGTAGCAGCTTCGGG + Intronic
1174529407 20:51199182-51199204 TCTGAAAAACTGGCAGCCTCAGG + Intergenic
1174564414 20:51454960-51454982 TAAGGACAACAGGCAGCCTCTGG - Intronic
1174677147 20:52369569-52369591 TAAGAGGAAGTGACAGCTTCCGG + Intergenic
1175797105 20:61778685-61778707 TGAGAAGAAGGGACAGCCTGGGG - Intronic
1176164827 20:63667393-63667415 TCAGAAGACATGGCGGCCTCGGG + Intronic
1178357374 21:31920151-31920173 TAAGCAGAGGGGGCAGCCACAGG - Intronic
1179499106 21:41795744-41795766 TAAGCAGCAAGGGCAGCCTCTGG + Intergenic
1183105284 22:35610949-35610971 TAAGAAGAAGGGGCATCATGAGG - Exonic
1184531201 22:45056799-45056821 TAAGATGCAGTGGAAACCTCAGG - Intergenic
1184660914 22:45965128-45965150 GAAGAGGATGTGGCAGCATCAGG - Intronic
1185003113 22:48258321-48258343 GGAGAAGAAGTTGCAGCCTTGGG - Intergenic
949414619 3:3800760-3800782 CCAGAAGGAGTGGCAGCCTCAGG + Intronic
950148325 3:10667399-10667421 TATGAAGAAAGGGCAGTCTCAGG - Intronic
951690176 3:25386809-25386831 TAAGAAGAGTTGGCAGCCCAAGG - Intronic
953613836 3:44471932-44471954 TGAGAAGCAGTGGGAGCTTCAGG + Intronic
953824285 3:46236589-46236611 TTAGAGGAACTGGAAGCCTCTGG - Intronic
955707811 3:61746590-61746612 TTAGACAAAGTGGAAGCCTCGGG - Intronic
956291986 3:67670242-67670264 TCAGATGAAGTGCCAGCCTTGGG + Intergenic
959623630 3:108425639-108425661 TCAGAGGAAGTGCCAGCTTCAGG + Intronic
963353378 3:144180105-144180127 TGAGAAATAGTGGCAGCTTCAGG - Intergenic
963732585 3:148987374-148987396 GAAGAAGCAGTGGCAGCAGCTGG + Intergenic
964025580 3:152070212-152070234 TAAGTAGAAATGTCAGCCTGGGG + Intergenic
967009353 3:185417590-185417612 TAAGAAGCAGAAGAAGCCTCTGG - Intronic
967621118 3:191635039-191635061 GACAAAGAAGTGGCAGCCCCAGG + Intergenic
967823272 3:193858088-193858110 GAAGGAGAAGTTGCAGCATCTGG + Intergenic
967918686 3:194598475-194598497 TAAGAAGAAGTGGCAGGGCTGGG - Intronic
968748039 4:2371032-2371054 CAAGAAGAAGAGCCAGACTCGGG - Intronic
970856882 4:20659493-20659515 CAAGATGAAGTGGCTGACTCTGG - Intergenic
972147644 4:36047642-36047664 GATGAAGAAGTGGTAACCTCAGG - Intronic
973015194 4:45129138-45129160 TAAGATGAAGTGACAGTCTTGGG + Intergenic
973584469 4:52376771-52376793 TGAGGAGAAGTGGAAGACTCTGG + Intergenic
973706165 4:53582898-53582920 TTTGAAGAAGTGGCAGGCGCTGG - Intronic
976100672 4:81559595-81559617 AAAGGAGAAGTGGCAGCCCAGGG - Intronic
977559227 4:98515692-98515714 TCACAGGAAGTGGCAGCATCCGG + Intronic
985310569 4:188593628-188593650 TCAGAAGAGGTGGCACCGTCAGG + Intergenic
985709318 5:1419469-1419491 TAGGAAGAATAGGCAGCCCCAGG - Intronic
985893823 5:2737750-2737772 CTACAAGAACTGGCAGCCTCAGG - Intergenic
987366796 5:17155972-17155994 TAAGAAGAATTGGCCTACTCAGG - Intronic
987371492 5:17197566-17197588 TAAGAAAAGGTGGCAACTTCAGG - Intronic
988156471 5:27458047-27458069 TAAGAAACAGTGGTTGCCTCTGG + Intergenic
989156502 5:38349542-38349564 TAACAATAAGTGGCAGAATCAGG + Intronic
989837034 5:46006245-46006267 TGAGAAGAGGGGCCAGCCTCAGG - Intergenic
990917016 5:60918453-60918475 TAAGAACAAGTAGTAGTCTCAGG + Intronic
993026617 5:82654266-82654288 GAAGAAGAAGTGGCAGGGTTTGG + Intergenic
993102780 5:83561617-83561639 AAAGAAGAAGAAGGAGCCTCTGG - Intronic
994191732 5:96876264-96876286 ACAGCAGAAGTGGCAGCCACTGG + Exonic
995395358 5:111681435-111681457 TAGAAAGAAAAGGCAGCCTCGGG - Intronic
996430196 5:123366942-123366964 GAAAAAGAATTGGCAGCCTCAGG - Intronic
998439513 5:142145326-142145348 TAAGATGGAGTGTCAGCCTCTGG - Intronic
1000986051 5:167861576-167861598 TATGAAGATGGGGCAGGCTCTGG + Intronic
1001874213 5:175185383-175185405 TCAGAAGGAGTGGCAAACTCAGG + Intergenic
1002087752 5:176786316-176786338 TACGAAGAAATGGCAGCCCAGGG - Intergenic
1002803613 6:550889-550911 AGAGAAGATGTGGCAGGCTCAGG - Intronic
1004258704 6:14088903-14088925 GAAGAAGCAGTGGCCGCCTGGGG + Intergenic
1004715429 6:18212307-18212329 TAAGCAGAAGTGGCAACCACAGG - Intronic
1005729751 6:28685442-28685464 TGAGAAGAGGGGCCAGCCTCAGG + Intergenic
1006234960 6:32621835-32621857 TAGAAAGAAGTGGTAACCTCTGG + Intergenic
1006718153 6:36133061-36133083 TAAGAAGCCTTGGCTGCCTCTGG + Intronic
1007237439 6:40401007-40401029 TCAGAGGATGTGGGAGCCTCTGG - Intronic
1007729452 6:43937089-43937111 GAAGGAGGAGTGGGAGCCTCAGG - Intergenic
1007797844 6:44365109-44365131 TGAGATGAAGTGGTAGGCTCAGG + Intronic
1011809382 6:91112948-91112970 CAAAAGGAAGGGGCAGCCTCAGG - Intergenic
1012218157 6:96614117-96614139 TAAGAAAAAGTAGAAGCATCTGG - Intronic
1013458966 6:110357828-110357850 AGAGAAGAAGCGGAAGCCTCCGG + Intronic
1017719720 6:157236121-157236143 GGAGAAGAAGTGGCATCCGCGGG + Intergenic
1019374845 7:683887-683909 GCAGAAGAAGTGGGGGCCTCTGG - Intronic
1021027771 7:15689084-15689106 TAAGAAGAAGTGGCAGCCTCGGG - Intergenic
1024523406 7:50327607-50327629 AAAGAAGAAGTGTGAGTCTCGGG - Intronic
1026339609 7:69424132-69424154 TGAGAGGAAGTGGCTGCCTGGGG + Intergenic
1027231933 7:76277762-76277784 AAAGAAGAAGTAGCTGGCTCAGG + Intronic
1029651797 7:101898403-101898425 GGAGAAGAACTGGCAGCCGCCGG + Intronic
1033889945 7:145999824-145999846 TAAGAACAAGTGTCAGCACCAGG - Intergenic
1035120936 7:156566258-156566280 TAGGAAGAAGAGGCTGCCTTTGG - Intergenic
1042205829 8:66328851-66328873 CAAGAGGAAGGGGCAGCATCAGG - Intergenic
1042655081 8:71087108-71087130 TCAGAAGTAGCGGCAGCCTGGGG - Intergenic
1044420898 8:91994743-91994765 TAATAAGAAGTGGGTTCCTCTGG - Intronic
1045805100 8:106149936-106149958 CAAGAAATAGGGGCAGCCTCTGG + Intergenic
1045871071 8:106927676-106927698 AAAGAAAAAGTGGCATCCCCAGG - Intergenic
1046613851 8:116454484-116454506 TAAAGAGAAGGGGAAGCCTCAGG - Intergenic
1047300531 8:123609863-123609885 TCAGAAGAAGTGGGAGTGTCGGG + Intergenic
1050463278 9:5895023-5895045 TGAGAACAAGAGGGAGCCTCTGG + Intronic
1051080343 9:13286782-13286804 TAAGAGAAAGTGCCAGCCTTTGG - Intergenic
1051924683 9:22309636-22309658 TCAGAAGAAGTGGCAGGATTTGG - Intergenic
1052853641 9:33393549-33393571 GAGAAAGAAGGGGCAGCCTCTGG - Intronic
1053681664 9:40489703-40489725 GAGAAAGAAGGGGCAGCCTCTGG - Intergenic
1053931659 9:43118033-43118055 GAAAAAGAAGGGGCAGCCTCTGG - Intergenic
1054282049 9:63135231-63135253 GAGAAAGAAGGGGCAGCCTCTGG + Intergenic
1054294757 9:63325220-63325242 GAGAAAGAAGGGGCAGCCTCTGG - Intergenic
1054392776 9:64629707-64629729 GAGAAAGAAGGGGCAGCCTCTGG - Intergenic
1054427426 9:65134916-65134938 GAGAAAGAAGGGGCAGCCTCTGG - Intergenic
1054502951 9:65886624-65886646 GAGAAAGAAGGGGCAGCCTCTGG + Intronic
1055728704 9:79258719-79258741 TAAGAAGAACAGGCACTCTCTGG - Intergenic
1056878822 9:90368478-90368500 TAAAAAGAACTGCCAGCTTCAGG + Intergenic
1058539619 9:105998154-105998176 TAAGAACCAGTGGCAGACTATGG - Intergenic
1059038401 9:110785602-110785624 TCAGAAGGAGCGGCATCCTCTGG - Exonic
1186029802 X:5355153-5355175 AAAGATGAAGTGTAAGCCTCGGG - Intergenic
1187810212 X:23167507-23167529 TAAGAAGAAATGGCAGTGACAGG + Intergenic
1188280094 X:28256487-28256509 TAAGCAGAAGAGGCAGAATCTGG + Intergenic
1189618030 X:42804762-42804784 AAAAAATAAGTGGCAGCCTGTGG + Intergenic
1190094416 X:47467296-47467318 TCAGAGGAAGTGGCAGATTCCGG - Intronic
1194282446 X:91969888-91969910 TAAAAAGAACTGGCAGAATCAGG - Intronic
1196609213 X:117691967-117691989 GAAGCAGAAGAGGCAGTCTCAGG - Intergenic
1200510460 Y:4072628-4072650 TAAAAAGAAGCTGCAGTCTCAGG - Intergenic
1201144273 Y:11054642-11054664 TCAGCATAAGTGGCAGACTCAGG - Intergenic
1202627461 Y:56874616-56874638 GAAGAAGAAGCGTCAGACTCAGG - Intergenic