ID: 1021038511

View in Genome Browser
Species Human (GRCh38)
Location 7:15831394-15831416
Sequence AACTTTCCCTAGAAGAACTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021038511_1021038519 27 Left 1021038511 7:15831394-15831416 CCTTAGTTCTTCTAGGGAAAGTT No data
Right 1021038519 7:15831444-15831466 CCAAGTTACAAAGAAGGGTAAGG No data
1021038511_1021038516 22 Left 1021038511 7:15831394-15831416 CCTTAGTTCTTCTAGGGAAAGTT No data
Right 1021038516 7:15831439-15831461 CTGTCCCAAGTTACAAAGAAGGG No data
1021038511_1021038515 21 Left 1021038511 7:15831394-15831416 CCTTAGTTCTTCTAGGGAAAGTT No data
Right 1021038515 7:15831438-15831460 CCTGTCCCAAGTTACAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021038511 Original CRISPR AACTTTCCCTAGAAGAACTA AGG (reversed) Intergenic
No off target data available for this crispr