ID: 1021041570

View in Genome Browser
Species Human (GRCh38)
Location 7:15869313-15869335
Sequence ATGTTTCCACAGGTGAACCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021041567_1021041570 -3 Left 1021041567 7:15869293-15869315 CCCGCAGGGAGGAGGCAGGGATG No data
Right 1021041570 7:15869313-15869335 ATGTTTCCACAGGTGAACCGTGG No data
1021041562_1021041570 8 Left 1021041562 7:15869282-15869304 CCGTTAGTTCTCCCGCAGGGAGG No data
Right 1021041570 7:15869313-15869335 ATGTTTCCACAGGTGAACCGTGG No data
1021041559_1021041570 25 Left 1021041559 7:15869265-15869287 CCTAGAAATCTCTGGTACCGTTA No data
Right 1021041570 7:15869313-15869335 ATGTTTCCACAGGTGAACCGTGG No data
1021041568_1021041570 -4 Left 1021041568 7:15869294-15869316 CCGCAGGGAGGAGGCAGGGATGT No data
Right 1021041570 7:15869313-15869335 ATGTTTCCACAGGTGAACCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021041570 Original CRISPR ATGTTTCCACAGGTGAACCG TGG Intergenic
No off target data available for this crispr