ID: 1021043220

View in Genome Browser
Species Human (GRCh38)
Location 7:15889635-15889657
Sequence CTGGGAATCTGGAGGTCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021043220_1021043226 4 Left 1021043220 7:15889635-15889657 CCTTCTGACCTCCAGATTCCCAG No data
Right 1021043226 7:15889662-15889684 GCTCCTCTCCACCCACCAGAAGG No data
1021043220_1021043232 27 Left 1021043220 7:15889635-15889657 CCTTCTGACCTCCAGATTCCCAG No data
Right 1021043232 7:15889685-15889707 TTACCCAGTGCACACCCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021043220 Original CRISPR CTGGGAATCTGGAGGTCAGA AGG (reversed) Intergenic
No off target data available for this crispr