ID: 1021044621

View in Genome Browser
Species Human (GRCh38)
Location 7:15907052-15907074
Sequence GTGTGTACGCACACGTGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021044621_1021044623 22 Left 1021044621 7:15907052-15907074 CCTGTGCACGTGTGCGTACACAC No data
Right 1021044623 7:15907097-15907119 GCTCTACATCCTCTATCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021044621 Original CRISPR GTGTGTACGCACACGTGCAC AGG (reversed) Intergenic