ID: 1021056176

View in Genome Browser
Species Human (GRCh38)
Location 7:16049086-16049108
Sequence TTCAGCCAACAAAACATTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021056173_1021056176 -10 Left 1021056173 7:16049073-16049095 CCATCCCAGAAAATTCAGCCAAC No data
Right 1021056176 7:16049086-16049108 TTCAGCCAACAAAACATTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021056176 Original CRISPR TTCAGCCAACAAAACATTTT AGG Intergenic
No off target data available for this crispr