ID: 1021060163

View in Genome Browser
Species Human (GRCh38)
Location 7:16101355-16101377
Sequence CTTCCTGGTTAGTTTAGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021060161_1021060163 14 Left 1021060161 7:16101318-16101340 CCTCAATTTCAGAACTTGCTACT 0: 3
1: 115
2: 1692
3: 2150
4: 7160
Right 1021060163 7:16101355-16101377 CTTCCTGGTTAGTTTAGTCTTGG No data
1021060160_1021060163 24 Left 1021060160 7:16101308-16101330 CCAATTATTGCCTCAATTTCAGA 0: 2
1: 4
2: 7
3: 21
4: 329
Right 1021060163 7:16101355-16101377 CTTCCTGGTTAGTTTAGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021060163 Original CRISPR CTTCCTGGTTAGTTTAGTCT TGG Intronic
No off target data available for this crispr