ID: 1021061503

View in Genome Browser
Species Human (GRCh38)
Location 7:16118234-16118256
Sequence TCTGAGGTACAGACTGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 200}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021061499_1021061503 4 Left 1021061499 7:16118207-16118229 CCCAAGGAGAAGTTTTACTTCTG 0: 1
1: 0
2: 3
3: 22
4: 246
Right 1021061503 7:16118234-16118256 TCTGAGGTACAGACTGTGGAAGG 0: 1
1: 0
2: 3
3: 18
4: 200
1021061496_1021061503 22 Left 1021061496 7:16118189-16118211 CCAATTTTGGGCGCACCACCCAA 0: 1
1: 0
2: 0
3: 4
4: 45
Right 1021061503 7:16118234-16118256 TCTGAGGTACAGACTGTGGAAGG 0: 1
1: 0
2: 3
3: 18
4: 200
1021061500_1021061503 3 Left 1021061500 7:16118208-16118230 CCAAGGAGAAGTTTTACTTCTGT 0: 1
1: 0
2: 3
3: 19
4: 256
Right 1021061503 7:16118234-16118256 TCTGAGGTACAGACTGTGGAAGG 0: 1
1: 0
2: 3
3: 18
4: 200
1021061498_1021061503 7 Left 1021061498 7:16118204-16118226 CCACCCAAGGAGAAGTTTTACTT 0: 1
1: 0
2: 1
3: 6
4: 157
Right 1021061503 7:16118234-16118256 TCTGAGGTACAGACTGTGGAAGG 0: 1
1: 0
2: 3
3: 18
4: 200
1021061495_1021061503 26 Left 1021061495 7:16118185-16118207 CCAGCCAATTTTGGGCGCACCAC 0: 1
1: 0
2: 0
3: 3
4: 38
Right 1021061503 7:16118234-16118256 TCTGAGGTACAGACTGTGGAAGG 0: 1
1: 0
2: 3
3: 18
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021061503 Original CRISPR TCTGAGGTACAGACTGTGGA AGG Intronic
902192762 1:14775055-14775077 TCTTAGGTGCAGAGTGTGGGTGG - Intronic
902404556 1:16175637-16175659 CCTGAGGTGGGGACTGTGGAGGG - Intergenic
903943123 1:26945280-26945302 TCTCAGGTGCAGGATGTGGATGG + Intronic
906307855 1:44731931-44731953 TCTTTGTTACATACTGTGGAAGG - Intergenic
907006610 1:50921135-50921157 TATGAGGTACACACTGTCCAGGG + Intronic
907823190 1:57990635-57990657 CCAGAGGTCCAGACTGAGGACGG + Intronic
910074156 1:83257749-83257771 TCTGAGCTTCAGACTTAGGAAGG + Intergenic
912255633 1:108055303-108055325 GCTGAGGTTAAGCCTGTGGATGG - Intergenic
914802672 1:150972724-150972746 TCTGAGGCACAGGCTGGAGAGGG + Intronic
915563451 1:156700887-156700909 TTTGAGGAGCAGACTGTGGATGG - Exonic
919762771 1:201108638-201108660 TCTGAGCTCCTGAGTGTGGAAGG - Intronic
920364671 1:205441816-205441838 TCTGAGGTAGAGGCTGAGGCTGG + Intronic
920770395 1:208879418-208879440 AATGAGGAACAGATTGTGGAAGG - Intergenic
920919168 1:210284090-210284112 TCTGAGGCACAGACAGGTGAGGG + Intergenic
921791409 1:219294722-219294744 CCTGAGGCACAGACTCTGGATGG + Intergenic
922005401 1:221525582-221525604 TCTGGGTTACAGACTTTGTAAGG + Intergenic
922311205 1:224392774-224392796 TTTGTGGTACAGACTGTAGAAGG - Intronic
923663202 1:235976911-235976933 TCTGAGGTACAGGATGGGGCTGG - Exonic
924676564 1:246184472-246184494 TCTGAGGTACAGATTGAGGATGG - Intronic
1063389077 10:5637165-5637187 TCTGAGTTTCACAGTGTGGATGG - Intergenic
1071242414 10:83722500-83722522 TCTGAGATACTGACAGTGGTGGG - Intergenic
1071463717 10:85921342-85921364 TCTGGGGAGCCGACTGTGGAAGG + Intronic
1072248663 10:93565119-93565141 TCTGAAGTACTGTCTGGGGAGGG - Intergenic
1072587380 10:96794988-96795010 ACTTAGGTACAGACTCTGGCAGG + Intergenic
1072605495 10:96978459-96978481 TCTGAAGTACATACTGGCGATGG - Intronic
1076649996 10:131981381-131981403 TCTGAACTACAGACCGCGGAGGG + Intronic
1076749296 10:132534334-132534356 CCTGACATATAGACTGTGGAAGG + Intergenic
1078406635 11:11075617-11075639 TCAGAGGCACACACTGTGGATGG - Intergenic
1078577281 11:12513157-12513179 TCTGGGGTATAGACTGTGCCGGG - Intronic
1079917800 11:26392416-26392438 TCTGTGGTATAAATTGTGGAAGG + Intronic
1085139035 11:74123212-74123234 TCTGAGGTTCTAAATGTGGAAGG + Intronic
1085662908 11:78386019-78386041 TCTCAGGCACTGACTGGGGATGG - Intronic
1087007232 11:93482206-93482228 TCTGAGATAACGACTGGGGAGGG + Intronic
1087220699 11:95543530-95543552 TCTGGGGTACAGACTGTGGGTGG - Intergenic
1088702177 11:112423127-112423149 TCTGAGGCTCAGACTTTTGAGGG + Intergenic
1089142446 11:116296839-116296861 TCAGAGGGACTTACTGTGGATGG - Intergenic
1089270262 11:117297038-117297060 TCTAAGGGGCAGACTGTGGCTGG - Intronic
1090245652 11:125214288-125214310 TCTGAGGAACAAACTGGGAATGG - Intronic
1092039198 12:5368625-5368647 TCTGCAGTGCAGGCTGTGGAGGG - Intergenic
1099038060 12:77614685-77614707 ACTGAGGCACTCACTGTGGAAGG - Intergenic
1100859224 12:98786875-98786897 TCTGAAGCACAGGCTGGGGAAGG + Intronic
1103675599 12:122653198-122653220 TGTGAGGGAAAGGCTGTGGAGGG + Intergenic
1104761787 12:131301105-131301127 TCTGAGGTGCGGCCTCTGGAGGG - Intergenic
1104817985 12:131659679-131659701 TCTGAGGTGCGGCCTCTGGAGGG + Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1105984680 13:25553783-25553805 TCTGAGGTGGTGTCTGTGGAAGG - Exonic
1107093950 13:36514894-36514916 TCCGAGGGGCAGACTGAGGAAGG + Intergenic
1109425591 13:62163069-62163091 TCTGAAGAACTGACTGGGGAAGG + Intergenic
1110697098 13:78503984-78504006 TCAGAAGTCCAGACTGTCGATGG - Intergenic
1111046851 13:82824876-82824898 TCTGAGGTGCACACAGTGGATGG - Intergenic
1111679185 13:91423459-91423481 TGGGAGATACAGACTTTGGAAGG + Intronic
1113024095 13:105921464-105921486 TCTGAGAGAGAGACTGGGGAGGG + Intergenic
1113272761 13:108692853-108692875 GCTGATGTCCACACTGTGGATGG + Intronic
1113404797 13:110028684-110028706 TCAGACATACAGACTGTGCAGGG - Intergenic
1113813310 13:113154763-113154785 TCTGATGTCCACATTGTGGATGG - Intergenic
1114661272 14:24346724-24346746 TCTGAGGGAGTGACTGAGGAAGG + Intergenic
1117228765 14:53693122-53693144 TCTAAGGTAAACACTGAGGAGGG + Intergenic
1117823067 14:59671693-59671715 TCTCTGGTACAGACAGTGGGTGG - Intronic
1120795736 14:88631115-88631137 TCTGAGGTGCAGTCTTAGGAGGG + Intronic
1121627682 14:95398568-95398590 TCTGAGGTACAGAGAGGGAATGG + Intergenic
1121888332 14:97565115-97565137 TCTTGGGGACAGAGTGTGGAGGG + Intergenic
1124702324 15:31926850-31926872 AATGAGGCACAGACTGTGCATGG - Intergenic
1126516304 15:49542261-49542283 TCTGAGTCACAGCCAGTGGAGGG + Intronic
1127325626 15:57892284-57892306 TCTGAAGGCCTGACTGTGGATGG - Intergenic
1127968062 15:63938673-63938695 TCTGGGGTACAGAATGGGCAGGG + Intronic
1129118057 15:73376304-73376326 TCTGTGATACAGACTGTGACAGG + Intergenic
1130556792 15:84928427-84928449 ACTGAGGAACTGACTGGGGAAGG - Intronic
1135349073 16:21713599-21713621 TGTGAGGTACAGAGTGTGTAAGG + Intronic
1135741324 16:24977605-24977627 TCTGATGTACATTGTGTGGAAGG - Intronic
1135983455 16:27166707-27166729 TCTGAGGCACAGACAGGTGAAGG + Intergenic
1137549353 16:49426577-49426599 TATGGGGTAGAGACTTTGGAGGG + Intergenic
1138238210 16:55403577-55403599 TTTGAATTACAGACTGTGTAAGG - Intronic
1139275725 16:65725854-65725876 ACTGAGGAATACACTGTGGAAGG + Intergenic
1140307143 16:73813743-73813765 TCTGAGGTACAGGAAGAGGAGGG - Intergenic
1143807580 17:9441981-9442003 TCTGAGAGTCAGCCTGTGGATGG - Intronic
1146293379 17:31629416-31629438 AGTAAGGTACAGATTGTGGACGG + Intergenic
1148235852 17:45968511-45968533 TCTGTGGCACAGACTGCTGAGGG - Intronic
1148337387 17:46851201-46851223 TCCGAGGTAGAGAAGGTGGAGGG - Intronic
1148887936 17:50787043-50787065 CCTGGGATCCAGACTGTGGAGGG - Intergenic
1149705575 17:58691836-58691858 TTTGTGGTACAGACTTGGGAAGG - Intronic
1151514339 17:74582503-74582525 TCTGAGGAGCAGACTAAGGAGGG + Intronic
1152077596 17:78168878-78168900 ACAGCGGGACAGACTGTGGAGGG - Intronic
1152191591 17:78891596-78891618 TCTCAGGGACAGAGTCTGGAGGG - Exonic
1155819433 18:30355610-30355632 TCTCAGGTACAGGCTGAGGCGGG + Intergenic
1156228137 18:35129148-35129170 TCTGAGGGACAGACAGGGGCAGG - Intronic
1158215093 18:55092469-55092491 TCTGAGCCACAGACTGTGCCAGG + Intergenic
1159081483 18:63740480-63740502 TCTGAGATTCAGACTGTGGTGGG + Intergenic
1159097711 18:63923181-63923203 TCTGAGGAATAGAGTGAGGAGGG - Intronic
1162328893 19:10014860-10014882 ACTAAGGTGCAGACTGTGAAAGG + Intronic
926712648 2:15894290-15894312 GCTGAGGTGCAGACTGGGGAGGG - Intergenic
927137551 2:20107922-20107944 ACTGAGCTACAGAATGAGGAGGG - Intergenic
929962505 2:46507127-46507149 TCCCAGGGAAAGACTGTGGATGG - Intronic
932224054 2:70024986-70025008 TTTGAGCTACAGACAGTGCAAGG - Intergenic
932226347 2:70044079-70044101 TCTGAGAACCAGACTGAGGAAGG - Intergenic
933354537 2:81196128-81196150 TCTGAGGTAGAGATGGTGGCGGG + Intergenic
935146106 2:100396588-100396610 TCTGCGGTACATGCTATGGATGG + Intronic
937060103 2:118974645-118974667 TCAGAGGTCCAGACTCTGGAGGG - Intronic
937065034 2:119011453-119011475 ACTGAGGAACAGCCTGGGGAAGG + Intergenic
939956702 2:148533388-148533410 GCTGGGGAACAGTCTGTGGAGGG - Intergenic
941013228 2:160325141-160325163 TCTGTGGCACAGTCTGTGGTTGG - Intronic
943279610 2:185915499-185915521 TCTGAGGGAAAGAATGTGCAAGG - Intergenic
944474206 2:200087213-200087235 TCTGGGCTTTAGACTGTGGACGG + Intergenic
948001650 2:234572686-234572708 TCTGAGATAAAGAATCTGGATGG + Intergenic
948546168 2:238730351-238730373 TCTGAGGTCCCTACTGAGGAGGG - Intergenic
1169067819 20:2704370-2704392 TCTAAGGAACACACTTTGGAAGG + Intronic
1170738511 20:19031859-19031881 TCTGACTTGCAGAGTGTGGAAGG - Intergenic
1171153290 20:22846824-22846846 CCTTAGGTATAGACTGTGGTGGG + Intergenic
1171252158 20:23656545-23656567 TCTGAGGTCAGGGCTGTGGAGGG + Intergenic
1173956914 20:47040411-47040433 ACTGAGGCTCAGACTGTGGAAGG - Intronic
1175506682 20:59490939-59490961 ACTGAGGTGGAGAATGTGGATGG + Intergenic
1175806130 20:61830315-61830337 TCTGAGGCAGAGGATGTGGATGG - Intronic
1177610817 21:23445570-23445592 TCTGAGGTACAGAATGTCCATGG - Intergenic
1179409316 21:41150011-41150033 TCTGAGACACAGACTATGGCTGG - Intergenic
1179793206 21:43767660-43767682 ACTGAGGCACAGACTGTGCATGG - Intergenic
1180929606 22:19579933-19579955 TCTGAAGGAAAGGCTGTGGAGGG + Intergenic
1180953144 22:19729816-19729838 GCCAAGGTACTGACTGTGGAAGG + Intergenic
1182438575 22:30347484-30347506 TCCCAGGTACAGACAGTGGTTGG - Intronic
1182680472 22:32075454-32075476 ACTGAGGTCCAGACAGGGGAAGG + Intronic
1183947191 22:41333105-41333127 ACTGAGGCACAGAGTGGGGAGGG + Intronic
950437427 3:12988667-12988689 TCTGAGGAGCAGGCTGGGGAGGG + Intronic
950465167 3:13149234-13149256 TCTGAGGTTCCCACTGTGAATGG - Intergenic
951280897 3:20748137-20748159 ACTGATGTGGAGACTGTGGAAGG + Intergenic
951638454 3:24806644-24806666 TATGAGCAACAGACTGTTGAAGG + Intergenic
953135395 3:40177366-40177388 CCTGACCTACAGGCTGTGGAGGG + Intronic
956585384 3:70859086-70859108 TTTGAGTTACAGAATGTGGTAGG + Intergenic
956758166 3:72410755-72410777 TCTGTGGTTCAGACTGAGAAAGG - Intronic
957387986 3:79521782-79521804 TCTCAGGAGCAGACCGTGGATGG - Intronic
959247227 3:103887632-103887654 TTTGGGCTAAAGACTGTGGAGGG - Intergenic
961911160 3:130317952-130317974 TCTGAGGCTCAGAATGGGGATGG - Intergenic
963765362 3:149329348-149329370 TCTGAGGTACAACCTGGGCATGG - Intronic
964610665 3:158611782-158611804 TCTGGGGTACAAAAAGTGGATGG - Intergenic
966986624 3:185186235-185186257 TCTGAGATGCAGCCTGTTGAGGG + Intergenic
967518317 3:190398411-190398433 TCTGAGGCAGAGACATTGGAGGG - Intronic
967544884 3:190713728-190713750 TCTGAGGTACAAAGATTGGATGG + Intergenic
975931394 4:79527922-79527944 TCTGAGATTTAGACTGTGGAAGG - Intergenic
976339680 4:83933262-83933284 TCTGAGGTAAAGTCTGGTGAGGG + Intergenic
977207564 4:94180311-94180333 TTTGAGGTACAGACTTTTGATGG - Intergenic
978362147 4:107942285-107942307 GCTGAGGTGCAGACAGTGGGTGG - Intronic
979612811 4:122707250-122707272 TGTGAGACATAGACTGTGGAGGG - Intergenic
981194977 4:141908827-141908849 TCTGAGGTAAGGCCTGTGGGTGG + Intergenic
982199507 4:152946631-152946653 TCTGCTGAACAGGCTGTGGAGGG - Intronic
982750828 4:159159175-159159197 GCTGAGGGAGACACTGTGGACGG - Intronic
984257848 4:177408790-177408812 TCTAAGATACACCCTGTGGATGG - Intergenic
985684069 5:1272526-1272548 TCTGATGTGGTGACTGTGGATGG - Intronic
985684076 5:1272560-1272582 TCTGATGTGGTGACTGTGGATGG - Intronic
985684082 5:1272594-1272616 TCTGATGTGGTGACTGTGGATGG - Intronic
985684117 5:1272772-1272794 TCTGATGTGGTGACTGTGGATGG - Intronic
985684131 5:1272842-1272864 TCTGATGTGGTGACTGTGGATGG - Intronic
985684191 5:1273141-1273163 TCTGATGTGGTGACTGTGGATGG - Intronic
985684219 5:1273283-1273305 TCTGATGTGGTGACTGTGGATGG - Intronic
985684233 5:1273353-1273375 TCTGATGTGGTGACTGTGGATGG - Intronic
985684272 5:1273541-1273563 TCTGATGTGGTGACTGTGGATGG - Intronic
985684279 5:1273575-1273597 TCTGATGTGGTGACTGTGGATGG - Intronic
985684304 5:1273686-1273708 TCTGATGTGGTGACTGTGGATGG - Intronic
985684311 5:1273720-1273742 TCTGATGTGGTGACTGTGGATGG - Intronic
988623199 5:32844535-32844557 TGTGAGGTATAGAATGAGGAGGG + Intergenic
989474382 5:41857423-41857445 TCTGAGGTCCAGATGTTGGAGGG - Intronic
990243462 5:53838588-53838610 TCCGAAGTGCAGACTTTGGAAGG + Intergenic
990514447 5:56518748-56518770 TCTGTGCTCCACACTGTGGAGGG + Intronic
991028867 5:62061617-62061639 TCAGAGGTACAAATTGGGGAGGG - Intergenic
992296986 5:75335660-75335682 TGTGAAGTACACACTGTGGTTGG - Intergenic
993889821 5:93460226-93460248 TCTTAGGTACAGACTCAGGAAGG + Intergenic
994250873 5:97535599-97535621 TCTGAGGTGCATACTTTGAAAGG + Intergenic
995792690 5:115908408-115908430 TCTAAGGTACTGATGGTGGAAGG + Intronic
998391070 5:141787285-141787307 TTTGAGGCCCAGACAGTGGAAGG - Intergenic
998420453 5:141980379-141980401 TGTGAGGGAGAGACTGGGGATGG - Intronic
999379215 5:151108631-151108653 TCTCAGGCACAGCCTGTGGGAGG - Intronic
1000023216 5:157336900-157336922 TCTGGGTTACATACTGTGCAGGG + Intronic
1000046901 5:157529483-157529505 TCTCAGGTACAGACTGTAATGGG + Intronic
1000179340 5:158792691-158792713 TCTGGGGCAAAGACTTTGGATGG + Intronic
1000507317 5:162137356-162137378 TCAGAGGTACACACTGTTGGTGG - Intronic
1001783645 5:174392696-174392718 TCTGAATTACAGCCTGTGGGGGG - Intergenic
1002040515 5:176510598-176510620 TCTGATTTACAGATTCTGGATGG + Intergenic
1003155062 6:3586374-3586396 TCTGAGGTAGAGAATGTCAAAGG - Intergenic
1003679224 6:8235597-8235619 CCTGAGGTACAGACAGAGCAGGG + Intergenic
1004224601 6:13774088-13774110 TCTAGGGTACAGACTGTAGTAGG - Intergenic
1004329144 6:14705672-14705694 TCTGAGGGAAAGACTTTGGATGG + Intergenic
1004772564 6:18800636-18800658 GGTGTGGCACAGACTGTGGAAGG + Intergenic
1005245958 6:23885452-23885474 ACAGAGGTACTCACTGTGGAAGG - Intergenic
1005683393 6:28228611-28228633 TCTGAGGTACATACTGGTTACGG - Intronic
1006563755 6:34936289-34936311 ACTGAGGTAGAGACTCTGAAGGG + Intronic
1006606479 6:35260700-35260722 ACTGAGGTCCAGACTGAGGAGGG - Intronic
1007570708 6:42888601-42888623 TCTGAGTTACAGATGGTGCAGGG - Exonic
1007679709 6:43625710-43625732 TCTCATGTCCACACTGTGGAAGG - Intronic
1008666288 6:53720249-53720271 TCAGAAGTACAGAAGGTGGAAGG - Intergenic
1011500382 6:87981969-87981991 TGAGAGGATCAGACTGTGGAGGG + Intergenic
1015106186 6:129539552-129539574 GCTGAGATACCAACTGTGGAGGG - Intergenic
1018940956 6:168308626-168308648 GCTGGAGTACAGACGGTGGAGGG - Exonic
1019381991 7:728633-728655 GCTGATGTACAGACTGGGTAGGG - Intronic
1021061503 7:16118234-16118256 TCTGAGGTACAGACTGTGGAAGG + Intronic
1026935285 7:74251302-74251324 TCTGAGGTTCAAACTGGGCATGG - Intronic
1027904222 7:84158661-84158683 TGTTAGGTACAGGCTGTGCAAGG - Intronic
1030871963 7:114766461-114766483 TCTGAGCTAAAGACTGTCTAAGG + Intergenic
1033609135 7:142948780-142948802 TCAGAGCTACAGGCTGTGGTGGG + Intronic
1035663003 8:1361329-1361351 TCTGAAGTAGAGACTGTGGAGGG - Intergenic
1035970216 8:4239493-4239515 TCTGAGGACCAGACTGGGGTGGG - Intronic
1037096592 8:14993682-14993704 CCTGAGGTAGAGATTGTGGATGG + Intronic
1037464740 8:19149136-19149158 TCTTATGAACAGACTGTGCAAGG + Intergenic
1037793460 8:21969198-21969220 TCTGAGGGACAGACACTAGAGGG - Intronic
1039246466 8:35613959-35613981 TCTGAGCTAAAGACTGTGTGTGG + Intronic
1040903125 8:52437993-52438015 TCTGAGGAACAGTGGGTGGAGGG - Intronic
1042722241 8:71839139-71839161 TCTTAGGAAGAGTCTGTGGAAGG + Intronic
1042944750 8:74144052-74144074 TCAGGGGTACAGATTGTGCAAGG + Intergenic
1044661987 8:94600574-94600596 TCTGAGGGAGAGGCTGGGGAGGG + Intergenic
1050482046 9:6097483-6097505 TCTGAGGCTCAGAATGGGGAAGG - Intergenic
1053731811 9:41064687-41064709 GCTGAGGTGGCGACTGTGGAAGG - Intergenic
1055062598 9:72085673-72085695 TCTGAAATACAGACTGTAAAAGG + Intergenic
1057950888 9:99368388-99368410 TCAGAAGAACAGACTGAGGATGG + Intergenic
1058868037 9:109179683-109179705 TCTGATTTGCAGAATGTGGATGG - Intronic
1060378285 9:123139040-123139062 TCTGAGATACATACTGTGTCAGG + Intronic
1061360245 9:130137070-130137092 TCTGAGGGAAGGACTGAGGAGGG - Exonic
1061407828 9:130402559-130402581 ACTGAGGTCCAGAGAGTGGAAGG + Intronic
1062673874 9:137728471-137728493 TCTGAGGTAGCGACTGATGAAGG - Exonic
1185881282 X:3743426-3743448 TCTGAGGTAGAGCCTGAGGCAGG + Intergenic
1185985089 X:4823744-4823766 TCAGAGGTACAGTGTGTGAAAGG - Intergenic
1186922031 X:14292842-14292864 TCTGAGGGGCACTCTGTGGAGGG - Intergenic
1189262843 X:39690037-39690059 GCTGAGGTTCTGCCTGTGGAAGG + Intergenic
1190108648 X:47575384-47575406 TCTGAGGCACTGATTGTGCACGG + Intronic
1196294026 X:113978604-113978626 TCAGAGGTTCAAAGTGTGGAGGG - Intergenic
1197705312 X:129630473-129630495 ATTGAGGTACAGAATGGGGAGGG + Intergenic
1200210154 X:154343546-154343568 TCTGAGGGACAGGCTCTGGGAGG + Intergenic
1200220698 X:154388546-154388568 TCTGAGGGACAGGCTCTGGGAGG - Intergenic