ID: 1021074067

View in Genome Browser
Species Human (GRCh38)
Location 7:16278899-16278921
Sequence TCAGAAGGTACCCTGATTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021074065_1021074067 -6 Left 1021074065 7:16278882-16278904 CCTCTATAGCAGGCAAATCAGAA 0: 1
1: 0
2: 0
3: 10
4: 144
Right 1021074067 7:16278899-16278921 TCAGAAGGTACCCTGATTCAAGG No data
1021074062_1021074067 13 Left 1021074062 7:16278863-16278885 CCAAAAGATATGAAGTCCTCCTC 0: 1
1: 0
2: 1
3: 28
4: 193
Right 1021074067 7:16278899-16278921 TCAGAAGGTACCCTGATTCAAGG No data
1021074060_1021074067 29 Left 1021074060 7:16278847-16278869 CCCTGGATGCATTCTTCCAAAAG 0: 1
1: 0
2: 0
3: 13
4: 167
Right 1021074067 7:16278899-16278921 TCAGAAGGTACCCTGATTCAAGG No data
1021074061_1021074067 28 Left 1021074061 7:16278848-16278870 CCTGGATGCATTCTTCCAAAAGA 0: 1
1: 0
2: 0
3: 12
4: 194
Right 1021074067 7:16278899-16278921 TCAGAAGGTACCCTGATTCAAGG No data
1021074064_1021074067 -3 Left 1021074064 7:16278879-16278901 CCTCCTCTATAGCAGGCAAATCA 0: 1
1: 0
2: 0
3: 9
4: 139
Right 1021074067 7:16278899-16278921 TCAGAAGGTACCCTGATTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021074067 Original CRISPR TCAGAAGGTACCCTGATTCA AGG Intronic
No off target data available for this crispr