ID: 1021075937

View in Genome Browser
Species Human (GRCh38)
Location 7:16304744-16304766
Sequence AGACTGACTTGAAATTTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 264}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021075937_1021075941 16 Left 1021075937 7:16304744-16304766 CCTCAGAAATTTCAAGTCAGTCT 0: 1
1: 0
2: 2
3: 17
4: 264
Right 1021075941 7:16304783-16304805 TGAACTCCCTGACTTTTCAGGGG No data
1021075937_1021075940 15 Left 1021075937 7:16304744-16304766 CCTCAGAAATTTCAAGTCAGTCT 0: 1
1: 0
2: 2
3: 17
4: 264
Right 1021075940 7:16304782-16304804 GTGAACTCCCTGACTTTTCAGGG No data
1021075937_1021075946 26 Left 1021075937 7:16304744-16304766 CCTCAGAAATTTCAAGTCAGTCT 0: 1
1: 0
2: 2
3: 17
4: 264
Right 1021075946 7:16304793-16304815 GACTTTTCAGGGGAAAGGGAAGG 0: 1
1: 1
2: 6
3: 63
4: 449
1021075937_1021075942 21 Left 1021075937 7:16304744-16304766 CCTCAGAAATTTCAAGTCAGTCT 0: 1
1: 0
2: 2
3: 17
4: 264
Right 1021075942 7:16304788-16304810 TCCCTGACTTTTCAGGGGAAAGG No data
1021075937_1021075944 22 Left 1021075937 7:16304744-16304766 CCTCAGAAATTTCAAGTCAGTCT 0: 1
1: 0
2: 2
3: 17
4: 264
Right 1021075944 7:16304789-16304811 CCCTGACTTTTCAGGGGAAAGGG No data
1021075937_1021075939 14 Left 1021075937 7:16304744-16304766 CCTCAGAAATTTCAAGTCAGTCT 0: 1
1: 0
2: 2
3: 17
4: 264
Right 1021075939 7:16304781-16304803 AGTGAACTCCCTGACTTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021075937 Original CRISPR AGACTGACTTGAAATTTCTG AGG (reversed) Intronic
900829157 1:4951884-4951906 ATACTGAATTGAAAACTCTGGGG + Intergenic
903632845 1:24789954-24789976 AGACTCCTTTGACATTTCTGTGG + Intronic
905081849 1:35329763-35329785 AGACTGGCTTCAAACTCCTGGGG + Intronic
907186435 1:52612881-52612903 AGACGGACTCTAAATTTCTGAGG - Intergenic
908016806 1:59848847-59848869 AGGCTGACTTTTAATTTCTTTGG + Intronic
908049762 1:60216490-60216512 AGAGTGACCAGAATTTTCTGAGG - Intergenic
908978029 1:69921643-69921665 AGACTGTTTTGAAATTCATGTGG - Intronic
911195636 1:94992517-94992539 GGACTGACTCGAAGTTACTGAGG + Intronic
912474341 1:109925962-109925984 TACCTGACTTGAAATATCTGAGG - Intronic
913078626 1:115361220-115361242 CCACTGAATAGAAATTTCTGAGG - Intergenic
913689574 1:121266452-121266474 ATACTCACTTGATATATCTGAGG + Intronic
914148024 1:145013820-145013842 ATACTCACTTGATATATCTGAGG - Intronic
914282820 1:146192427-146192449 AAACTGATTTAAAATATCTGGGG - Intronic
914397132 1:147280358-147280380 AAACTAACTGGAAATTTGTGTGG + Intronic
914543850 1:148643143-148643165 AAACTGATTTAAAATATCTGGGG - Intronic
914622771 1:149427866-149427888 AAACTGATTTAAAATATCTGGGG + Intergenic
914857519 1:151363415-151363437 AGAAGGACATGAAATTTGTGGGG + Intergenic
915905907 1:159876994-159877016 AGACTGCCTGGAGATGTCTGAGG - Intronic
916398086 1:164413510-164413532 AGAAGGACTTGAAATTTAAGGGG + Intergenic
916673467 1:167045908-167045930 ATAATCTCTTGAAATTTCTGGGG + Intergenic
918113691 1:181479913-181479935 AGCCTGACTCCAAACTTCTGAGG - Intronic
920476897 1:206284926-206284948 ATACTCACTTGATATATCTGAGG + Intronic
920798140 1:209160552-209160574 ATACTGATTTGATTTTTCTGTGG - Intergenic
922043532 1:221920682-221920704 AGAATGATTTGATATTTCTCTGG - Intergenic
923061612 1:230480536-230480558 AGACTGAGTTCAAATTCTTGGGG + Intergenic
923814256 1:237358198-237358220 TGTATGACTTGAAATGTCTGTGG - Intronic
924485638 1:244481061-244481083 ACAGTAACTTCAAATTTCTGGGG - Intronic
1064039030 10:11941830-11941852 ATAGTTACTTGAAATTACTGTGG + Intronic
1064411005 10:15103941-15103963 AGACAGAATTGAAGATTCTGGGG + Exonic
1066163905 10:32764922-32764944 AGTCTGACTTGAGATATCTATGG + Intronic
1066210008 10:33227359-33227381 ATACTGACTTGAAAGCTCTAAGG + Intronic
1066520681 10:36214930-36214952 AGACTGTCATGAAAGTTTTGGGG - Intergenic
1067700802 10:48570567-48570589 AGACTGACTGAAATTTGCTGTGG + Intronic
1068235904 10:54232040-54232062 AGAATGACATGAGATTTCAGAGG + Intronic
1068797174 10:61096172-61096194 TGAATGAATTGAAATGTCTGTGG + Intergenic
1068818604 10:61346669-61346691 AGATTGGCCTGAAATTTCTAAGG - Intergenic
1069267463 10:66479979-66480001 GGGCTGAGTTGAAAGTTCTGGGG - Intronic
1069598132 10:69686083-69686105 AGACTGAATGGTAGTTTCTGGGG + Intronic
1070231776 10:74575095-74575117 ACACTGACTTGATTTTTTTGTGG - Intronic
1070596508 10:77836281-77836303 AGTTTGACTTGAAATTTTAGTGG - Intronic
1072715079 10:97745929-97745951 TAACTGACTCGGAATTTCTGGGG - Intronic
1073606291 10:104899169-104899191 AGACAGACCTGATATTTCAGAGG + Intronic
1078597905 11:12704293-12704315 AGACAGAGTTGAAGTGTCTGAGG + Intronic
1079280311 11:19081409-19081431 AAACTGATTTGAAATTTCAGGGG - Intergenic
1080036226 11:27714507-27714529 AGAATGATCTCAAATTTCTGCGG - Intronic
1080441327 11:32297583-32297605 AGACTAACTTGAAAATCCAGAGG + Intergenic
1087437383 11:98138786-98138808 TCACTGACTTCATATTTCTGAGG + Intergenic
1089672629 11:120067139-120067161 AGACAGACTGCAAATCTCTGTGG - Intergenic
1090029254 11:123194047-123194069 GGAGTGACTGGAAATGTCTGAGG - Intronic
1090857752 11:130625089-130625111 AGCCTGACCTGACATTTTTGTGG - Intergenic
1090871055 11:130748247-130748269 AGTCTAAATTGGAATTTCTGGGG - Intergenic
1090975913 11:131679760-131679782 ATACTGACTTGGAAACTCTGGGG + Intronic
1091182349 11:133618336-133618358 AGAATGACATGAAAACTCTGAGG + Intergenic
1091432856 12:451611-451633 AGACTGATGTGAAGTCTCTGAGG + Intergenic
1093593896 12:20939454-20939476 AGACTGACATCAAATCACTGAGG - Intergenic
1093919895 12:24848136-24848158 AAATTGACTTGAAATCTCTTAGG - Intronic
1098217716 12:68237605-68237627 AAATTGAATTGAAATTTCTAAGG + Intergenic
1099198214 12:79644853-79644875 AGACAAACTTTAAATTTCTGAGG + Intronic
1099284477 12:80700082-80700104 ATGCTCACTTGAAATTACTGAGG - Intergenic
1102239669 12:111316659-111316681 AGACTGGTTTCAAATTCCTGAGG + Intronic
1102317102 12:111898043-111898065 AAATTGACCTGAAATGTCTGTGG - Intergenic
1105316006 13:19264243-19264265 ATACTGTCTTGAAACTCCTGCGG + Intergenic
1105742282 13:23339627-23339649 TGACTTACTTGAAGATTCTGTGG - Exonic
1106039864 13:26079560-26079582 AGACTTACTTAGCATTTCTGGGG + Intergenic
1106211509 13:27652359-27652381 AGACTGTCTTGAGATTTGTGTGG + Intronic
1109162644 13:58994570-58994592 AGAGTGACTTGAATTTTATAAGG + Intergenic
1109928100 13:69174296-69174318 ATACTGAAGTGAAATTTGTGTGG + Intergenic
1110466763 13:75811085-75811107 AAACACACTTGAATTTTCTGAGG - Intronic
1110874565 13:80492252-80492274 AAACTGATTTCAAATCTCTGGGG + Intergenic
1111080419 13:83299297-83299319 TGACTGACTGGGAATTTGTGAGG + Intergenic
1111470827 13:88680282-88680304 AGATTGGCTTTAAATTGCTGTGG - Intergenic
1112251839 13:97788539-97788561 TGACTGAATTGAATTTTCTTTGG + Intergenic
1114946428 14:27687192-27687214 AGACTGCCTTAAAGTTTCTTGGG - Intergenic
1115141676 14:30178524-30178546 AGACTCACTTGAAATGTATGTGG + Intronic
1115215626 14:31011247-31011269 AGCTTGACTTACAATTTCTGTGG - Intronic
1115925343 14:38427378-38427400 AGGATGACCTGACATTTCTGAGG - Intergenic
1115939508 14:38592406-38592428 AGATTGACTAGACATTTCTAGGG - Intergenic
1116936369 14:50744725-50744747 AGACTGACCTCAAACTCCTGAGG - Intronic
1117455774 14:55895500-55895522 AGACAGATTTTAAATTGCTGTGG - Intergenic
1117739217 14:58798835-58798857 AGGCTGACTTTACATTTCTTAGG + Intergenic
1118579870 14:67285190-67285212 GGTTGGACTTGAAATTTCTGAGG + Intronic
1119071704 14:71592219-71592241 TGTCTGACTTGAAAGTTGTGTGG - Intronic
1119654445 14:76407181-76407203 CGACTGACTCAGAATTTCTGAGG - Intronic
1122047007 14:99030837-99030859 AGGCTGACTTGCAATTGCCGGGG + Intergenic
1123813131 15:23949273-23949295 AGAAAGACTTGAAATTTATTGGG + Intergenic
1125321790 15:38496699-38496721 AGGCTGACTTCAAACTTTTGGGG - Intronic
1125632163 15:41156100-41156122 AGAATTACTAGAAAGTTCTGTGG + Intergenic
1126032099 15:44508990-44509012 AGACTCACATGTAATTTTTGGGG + Intronic
1126750229 15:51869379-51869401 ATAATGACTTTAAAATTCTGGGG - Intronic
1127899020 15:63327525-63327547 AGATTGACTTTGAATCTCTGGGG - Intronic
1128706433 15:69840477-69840499 AGACTGACTTGTCAATTCTATGG + Intergenic
1129289262 15:74551049-74551071 AGACTGACTTTTAATATATGTGG - Intronic
1133761511 16:8802347-8802369 AGTCTGACTTGATAGGTCTGTGG + Intronic
1135196703 16:20400930-20400952 AAACAGACTTAAAATTTATGAGG - Intronic
1138236219 16:55385421-55385443 TTACTGAATTGGAATTTCTGAGG + Intergenic
1140095643 16:71873495-71873517 AGTCTAACTAGATATTTCTGAGG + Intronic
1145115610 17:20208341-20208363 AGACTGATTTGTAATTGCAGTGG + Intronic
1145396981 17:22504095-22504117 AGATTGACTTTAAATTTCTAAGG + Intergenic
1146227749 17:31081724-31081746 AGAATCACTTGAAAGTTGTGAGG - Intergenic
1147390100 17:40103806-40103828 AGACTGACTAGAAGCTTCTGGGG - Intergenic
1148350314 17:46936826-46936848 AGTTTGACTTGTAATTTCTCTGG + Intronic
1150033143 17:61762880-61762902 AAACTGACTTCAAATTTTAGGGG - Intronic
1151155462 17:72121042-72121064 AAACTGACTGGAAACTTCAGTGG + Exonic
1151885525 17:76921229-76921251 GGACCACCTTGAAATTTCTGCGG + Intronic
1153739439 18:8107660-8107682 AGACTGGCCAGAAATTGCTGTGG - Intronic
1154224711 18:12492863-12492885 ACACTTACTTGAAATTTATAGGG - Intronic
1155833400 18:30546389-30546411 AACGTGACTTTAAATTTCTGTGG + Intergenic
1157290075 18:46403487-46403509 AGACTGTTATGAAATGTCTGTGG - Intronic
1157903190 18:51540797-51540819 AGACTGACTTCATATTTTTATGG + Intergenic
1159356409 18:67342248-67342270 AGAGTGACTCAAAATTTCTTAGG - Intergenic
1160000830 18:75019976-75019998 AGTTTGACTTGAAATTTGGGTGG + Intronic
1168366408 19:55791956-55791978 GGCCTGGCTTGCAATTTCTGAGG - Intronic
925974209 2:9129936-9129958 AGGCTGACCTCAAATTCCTGGGG + Intergenic
926037117 2:9644570-9644592 TGACTAAGTTGGAATTTCTGAGG - Intergenic
926188682 2:10711232-10711254 AGACTGGTTTTGAATTTCTGGGG - Intergenic
927992661 2:27459162-27459184 AGACTCACTTTATATATCTGGGG + Intronic
928640303 2:33291164-33291186 AGAATGCCTTGAAATATCTAGGG - Intronic
929873251 2:45775437-45775459 ATACTGCCTTTGAATTTCTGGGG + Intronic
931213800 2:60223121-60223143 AGTGTGACTTGAAATTACTTTGG - Intergenic
932318413 2:70801881-70801903 AGACTGACTGGAACCATCTGGGG - Intergenic
933967954 2:87445491-87445513 GATCTGACTTGAATTTTCTGAGG - Intergenic
935966012 2:108476729-108476751 AGACTGACTTCTGAGTTCTGGGG + Intronic
936325840 2:111505022-111505044 GATCTGACTTGAATTTTCTGAGG + Intergenic
936832902 2:116670738-116670760 AAACAGCCTTGGAATTTCTGTGG - Intergenic
937544348 2:122998694-122998716 AGAATGATTTCAAATTTCTTTGG - Intergenic
937677887 2:124611637-124611659 TTACTGAATTGGAATTTCTGGGG - Intronic
937726268 2:125170036-125170058 TAACTGACTTGAAATCTCTGTGG - Intergenic
937860280 2:126702743-126702765 AGACAGCCTAGAAATTACTGAGG + Intergenic
938813917 2:134880137-134880159 ACAATGACTTTAAAATTCTGAGG - Intronic
939752963 2:146071382-146071404 TTACTAACTTTAAATTTCTGAGG + Intergenic
942936661 2:181565145-181565167 AGACTGATTTGAATGTGCTGGGG - Intronic
943709342 2:191073199-191073221 AGAATGTCTTGAAATCTCTCTGG + Intronic
945592495 2:211751451-211751473 AGATTCACTCTAAATTTCTGTGG + Intronic
945860185 2:215112454-215112476 ATACTGCATTGAAATTTCTTTGG + Intronic
945992791 2:216410501-216410523 TTACTGAATTGGAATTTCTGGGG + Intergenic
945999159 2:216466211-216466233 AGAAAGACTTAAAATTTCTAAGG - Intronic
946438747 2:219677489-219677511 AGTGTGACATGAAATATCTGTGG + Intergenic
949055531 2:241926329-241926351 AGAGTGAGTAGATATTTCTGGGG + Intergenic
1169767595 20:9164802-9164824 AGACTGTCAGGAGATTTCTGGGG + Intronic
1170381910 20:15770403-15770425 AGACTGACTTCACTTCTCTGGGG + Intronic
1173010051 20:39174248-39174270 GGACTGACTTGAAATCTTTCTGG - Intergenic
1173307220 20:41862194-41862216 AGCCTGACTTGAAATTGCCTTGG + Intergenic
1173697312 20:45029696-45029718 AGACTGAATAGGAATATCTGGGG + Intronic
1176726357 21:10437805-10437827 AGACTACCTTGCAATTTCAGGGG + Intergenic
1177352028 21:19955180-19955202 AGACTGACTTTATTTTTTTGGGG + Intergenic
1177985073 21:27964013-27964035 AGACTGTCATGAACATTCTGTGG - Intergenic
1179588561 21:42389748-42389770 AGACTGACTTTACATTCATGTGG + Intronic
1179791143 21:43756707-43756729 AGACCGACTTGAATTTGCTGGGG - Exonic
1179838144 21:44051269-44051291 AGAGTGACTTGAAAGTCCGGAGG + Intronic
1180288022 22:10769292-10769314 AGACTACCTTGCAATTTCAGGGG - Intergenic
1181624940 22:24116874-24116896 AGACTGGCTTGGAATGCCTGTGG - Intronic
1183124258 22:35760354-35760376 AGACAGACTTTTAATTACTGTGG + Intronic
1183966327 22:41445061-41445083 AGCTTGACTGGAAATTTCTTTGG - Intronic
1184249478 22:43251981-43252003 AGACTTACATGAAACCTCTGAGG - Intronic
1184630241 22:45771832-45771854 AGACTGACCTCAAATTCCTTGGG + Intronic
1185000286 22:48241400-48241422 AGACAGAATTGAAATTTCAGGGG - Intergenic
949369954 3:3324148-3324170 AAACTGACATGAAATTTTGGGGG - Intergenic
951002699 3:17582244-17582266 AGACTGGCTTCAAATTTCTCAGG + Intronic
951863430 3:27279616-27279638 AGAATGACATCAAATCTCTGTGG + Intronic
955027294 3:55181473-55181495 AGACTGACTGCACATTTCTTTGG - Intergenic
956358720 3:68422465-68422487 CAACTGACCTGAAATTTCAGAGG - Intronic
956397295 3:68839817-68839839 AAACTGGCTAGAAATTTCCGAGG + Intronic
957142187 3:76374745-76374767 AGAATGACTGGCAATTTCAGTGG + Intronic
957272937 3:78054960-78054982 AGACTGACTTCCATTTGCTGTGG + Intergenic
958685317 3:97386023-97386045 AGAAGGACATGAAATTTTTGAGG - Intronic
961405462 3:126676648-126676670 GGACTGTCTCCAAATTTCTGGGG + Intergenic
962695547 3:137943933-137943955 AGACTGCCTTGAAACTTCTGAGG - Intergenic
962742693 3:138373592-138373614 ATACTGATTTGGAAATTCTGAGG + Intronic
964117610 3:153152849-153152871 CCACTGAATAGAAATTTCTGAGG - Intergenic
964298130 3:155256528-155256550 AGACTGAGTTAATATTTTTGAGG + Intergenic
964807990 3:160632428-160632450 AAACTGACTTTAAATTTGGGGGG - Intergenic
965106848 3:164367638-164367660 AGACTAACTTTAAAATTATGGGG - Intergenic
971053120 4:22883331-22883353 TGACTGCCTTGTTATTTCTGAGG - Intergenic
971676166 4:29632075-29632097 ACAATGACTTAAAATTTCTACGG - Intergenic
971859717 4:32088114-32088136 GGGCTGTCTTGGAATTTCTGAGG + Intergenic
974300494 4:60059709-60059731 AAACTGATTTGAAATTACTTTGG - Intergenic
976372818 4:84309690-84309712 ACACTAACCTGAAATCTCTGAGG + Intergenic
977620652 4:99133260-99133282 AGACTCACTTGCAAATTGTGGGG - Intronic
978198975 4:106002728-106002750 AGACATACTGGAAACTTCTGGGG + Intronic
978531354 4:109717410-109717432 ACACAGACTTCAATTTTCTGAGG - Intronic
979840325 4:125431435-125431457 AGACTGAATTGAAAGGTTTGGGG + Intronic
982752707 4:159181554-159181576 AGACTGTCTTCCCATTTCTGAGG - Intronic
982759576 4:159265352-159265374 ACACTAACATGAGATTTCTGAGG + Intronic
983049027 4:163022172-163022194 AGACTGGGTTAAAATTTATGTGG - Intergenic
983974683 4:173919251-173919273 AGTATGACTTCAAATGTCTGTGG - Intergenic
986920525 5:12674163-12674185 CTACTGGCTTGAAATTTTTGCGG - Intergenic
987266963 5:16265928-16265950 AGACTGACTGGAAATGTTTTGGG - Intergenic
987340970 5:16938449-16938471 AAACTGACTCCAAATCTCTGTGG + Intergenic
987641565 5:20618279-20618301 AGATTAATTTGAAATTTATGAGG - Intergenic
989322446 5:40151937-40151959 AGAATTACTTGGATTTTCTGAGG + Intergenic
989333114 5:40282835-40282857 AAACTGTCTTTTAATTTCTGAGG - Intergenic
991152922 5:63392995-63393017 AGACAAACCTGTAATTTCTGTGG + Intergenic
993323308 5:86502777-86502799 AGAATAACTTCAAATTACTGGGG - Intergenic
993570187 5:89527044-89527066 ACACTGACTTCAAATTTATCTGG - Intergenic
994488245 5:100406993-100407015 ATATTGAACTGAAATTTCTGGGG + Intergenic
995844907 5:116483068-116483090 AGACTAACATAAAATTTGTGTGG - Intronic
996757837 5:126953558-126953580 AGAATTACTTCAAATTTCTGAGG - Intronic
997384442 5:133461623-133461645 TGACTGACTGGACATATCTGGGG + Intronic
997435618 5:133872544-133872566 ACAATGCCTTCAAATTTCTGAGG + Intergenic
997869600 5:137496180-137496202 AATCTGACTTTACATTTCTGGGG - Intronic
997952704 5:138254485-138254507 AGAGTGACTTGAAATTTTTCTGG - Intronic
998902224 5:146868355-146868377 AGCCAGACCTGGAATTTCTGGGG + Intronic
999224628 5:150010772-150010794 AGAGTTCCTTGAAATTTCTCAGG + Intronic
999627194 5:153533257-153533279 AGACTGAATTGAAATGCCTTTGG - Intronic
1000715651 5:164640728-164640750 AGACTTACTGGCAATTTGTGTGG + Intergenic
1003528429 6:6917673-6917695 AGACTGACTACAAGCTTCTGGGG - Intergenic
1003931217 6:10926364-10926386 AGACTTACTAAAAAGTTCTGAGG - Exonic
1005411240 6:25549183-25549205 ACTCTGACATGAAATTTCTGTGG - Intronic
1007315801 6:40987895-40987917 CGACTGTCTTGCAGTTTCTGTGG + Intergenic
1008443923 6:51565717-51565739 TTATTGACTTGAAATTTTTGAGG - Intergenic
1008453002 6:51674523-51674545 ATACTGAGTTAAAATTGCTGTGG - Intronic
1009777634 6:68225632-68225654 AGAAAGACTTGAAGTTTCAGAGG + Intergenic
1009849971 6:69183323-69183345 AAAGTGATTTGAAATTTTTGTGG + Intronic
1009884490 6:69609245-69609267 AAACTGATTTTAAATTTTTGGGG + Intergenic
1009919344 6:70038292-70038314 TGATTGAATTGGAATTTCTGGGG - Intronic
1010564145 6:77388206-77388228 ACAGTGAATTCAAATTTCTGAGG - Intergenic
1010939512 6:81899462-81899484 AGACAGACTGGAAACTTCTCAGG + Intergenic
1011229477 6:85144067-85144089 AGACTGACTTCAATTGACTGGGG + Intergenic
1012857760 6:104523192-104523214 AAACTGAATTTAAATTTCAGTGG + Intergenic
1015537312 6:134279649-134279671 AGAATGACTTGCTATTTTTGGGG - Intronic
1016769786 6:147836129-147836151 AGCCTGCCTTGAAAATACTGGGG - Intergenic
1017734800 6:157352105-157352127 AGACTGACTTGAATTTTGGAAGG + Intergenic
1018253125 6:161892221-161892243 AGACTGACCTCTAACTTCTGGGG - Intronic
1019616713 7:1966327-1966349 AGGCTGACTTGAAATCTCTGTGG - Intronic
1019797438 7:3061917-3061939 AGACTGTCTTGAATATTCTGGGG + Intergenic
1021075937 7:16304744-16304766 AGACTGACTTGAAATTTCTGAGG - Intronic
1021205906 7:17780561-17780583 AAACTCACTTGAAGATTCTGTGG - Intergenic
1021888944 7:25168648-25168670 AGAATGAGGTTAAATTTCTGAGG + Intronic
1022067034 7:26869285-26869307 AGACTGACTCAGAATCTCTGGGG - Intronic
1023387339 7:39672974-39672996 AAACTGACTCGAACTTTTTGAGG - Intronic
1025592983 7:62886755-62886777 TCACAGACTTTAAATTTCTGTGG + Intergenic
1026264004 7:68780570-68780592 AGACCCACCTCAAATTTCTGGGG + Intergenic
1027730814 7:81870183-81870205 AGAATGATTTGAGTTTTCTGTGG - Intergenic
1028014341 7:85687749-85687771 AGAAGGACATGAAATTTGTGGGG + Intergenic
1028630690 7:92930224-92930246 AGCCTGACTAGGGATTTCTGAGG - Intergenic
1030871928 7:114766165-114766187 TGACTGACTTAATATCTCTGTGG + Intergenic
1033010256 7:137614370-137614392 AGACTTACGTGAATTTTCTGTGG - Intronic
1033719032 7:144037281-144037303 AGAATGAGTTTTAATTTCTGGGG + Intergenic
1034603749 7:152290179-152290201 AGACTACCTTGCAATTTCAGGGG - Intronic
1036411308 8:8504283-8504305 AGCCTGTCTTGGAGTTTCTGAGG - Intergenic
1037416179 8:18652298-18652320 AGAGTGAATTGCAATTGCTGAGG + Intronic
1037509195 8:19564356-19564378 AAACGAAATTGAAATTTCTGAGG - Intronic
1038882018 8:31625400-31625422 AGAGTGAATAGAAATTTCTAGGG - Intergenic
1044362634 8:91306460-91306482 AGACTTACCTGAAGATTCTGTGG + Intronic
1044728959 8:95215011-95215033 AGACTGAGTTTGAATCTCTGTGG + Intergenic
1046549195 8:115691501-115691523 ACACTTACTTGCAATTTTTGTGG - Intronic
1046712973 8:117534008-117534030 GGAATGCCTTCAAATTTCTGAGG - Intronic
1047198845 8:122746533-122746555 AAACTGACCTGAAATTACAGAGG - Intergenic
1047354829 8:124110510-124110532 AGTCTGAGGTGATATTTCTGGGG + Intronic
1048839595 8:138553127-138553149 AGACTAAAGTGGAATTTCTGGGG + Intergenic
1050398907 9:5230070-5230092 AGGCTGCCTTGGAATTTGTGGGG + Intergenic
1050674154 9:8032991-8033013 AGACTCTCTTGAAAACTCTGAGG - Intergenic
1052013337 9:23436988-23437010 ATAGCGACTTGAAAATTCTGTGG + Intergenic
1053576330 9:39359521-39359543 GGACTGACTGGAAAGTTCTCAGG - Exonic
1053840841 9:42187446-42187468 GGACTGACTGGAAAGTTCTCAGG - Exonic
1054097899 9:60918212-60918234 GGACTGACTGGAAAGTTCTCAGG - Intergenic
1054119301 9:61193842-61193864 GGACTGACTGGAAAGTTCTCAGG - Exonic
1054588452 9:66988720-66988742 GGACTGACTGGAAAGTTCTCAGG + Intergenic
1055155660 9:73059871-73059893 AGCATGACTTGAATTTTGTGAGG - Intronic
1055986478 9:82059889-82059911 GGACTGACTGGAAAGTTCTCAGG + Intergenic
1056584864 9:87921243-87921265 GGACTGACTGGAAAGTTCTCAGG - Intergenic
1056612017 9:88131697-88131719 GGACTGACTGGAAAGTTCTCAGG + Intergenic
1057160693 9:92886295-92886317 GGACTGACTGGAAAGTTCTCAGG - Intergenic
1186564844 X:10651516-10651538 TGACTGTCTTCAAATATCTGTGG - Intronic
1188215775 X:27475169-27475191 AAAATGACTTTAAATTGCTGAGG + Intergenic
1189723027 X:43940055-43940077 AGTCTGACTTAAAATTTCCTCGG + Intergenic
1189725612 X:43965505-43965527 AAACTGTCTTAAAATTTGTGGGG + Intronic
1189732709 X:44038297-44038319 ACACTGACTTTACATTTCTGAGG + Intergenic
1189734060 X:44051331-44051353 AGAATGACTTAAAATTCTTGGGG + Intergenic
1189754935 X:44261459-44261481 AGAATGAGCTGAGATTTCTGAGG + Intronic
1189876239 X:45439474-45439496 AGCCTGCCTTGAATTTTATGGGG + Intergenic
1191698093 X:64009902-64009924 AGACTCACTTGAAGGTTCGGAGG - Intergenic
1192396758 X:70789787-70789809 AAACTGACTTCAAATATTTGGGG - Intronic
1193332522 X:80250920-80250942 CAACTGTCTTGAAGTTTCTGGGG + Intergenic
1193578025 X:83227900-83227922 ATACTGGCTTGAAATTTCCTTGG + Intergenic
1196670471 X:118361424-118361446 AAAATAACTTTAAATTTCTGTGG - Intronic
1197155955 X:123270436-123270458 ACACTGACTTTAGATTTATGTGG - Intronic
1198030611 X:132750281-132750303 TGACTGACTTGAATTTTTGGAGG + Intronic
1198774114 X:140161618-140161640 ACAATGACTGGAAATTTCAGAGG - Intergenic
1200183022 X:154162770-154162792 AGATTGACTTCATATTCCTGAGG - Intergenic
1200188676 X:154199884-154199906 AGATTGACTTCATATTCCTGAGG - Intergenic
1200194325 X:154237025-154237047 AGATTGACTTCATATTCCTGAGG - Intergenic
1200200081 X:154274828-154274850 AGATTGACTTCATATTCCTGAGG - Intronic
1202150171 Y:21837165-21837187 ACACTGACTGAAAATGTCTGTGG + Intergenic