ID: 1021075940

View in Genome Browser
Species Human (GRCh38)
Location 7:16304782-16304804
Sequence GTGAACTCCCTGACTTTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021075937_1021075940 15 Left 1021075937 7:16304744-16304766 CCTCAGAAATTTCAAGTCAGTCT 0: 1
1: 0
2: 2
3: 17
4: 264
Right 1021075940 7:16304782-16304804 GTGAACTCCCTGACTTTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021075940 Original CRISPR GTGAACTCCCTGACTTTTCA GGG Intronic
No off target data available for this crispr