ID: 1021083674

View in Genome Browser
Species Human (GRCh38)
Location 7:16393558-16393580
Sequence TGGAGTTTACAGATTGAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 188}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021083674_1021083678 29 Left 1021083674 7:16393558-16393580 CCCTACTCAATCTGTAAACTCCA 0: 1
1: 0
2: 1
3: 12
4: 188
Right 1021083678 7:16393610-16393632 TATAACACATTTTTTAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021083674 Original CRISPR TGGAGTTTACAGATTGAGTA GGG (reversed) Intronic
903836129 1:26204284-26204306 AGGAGCTAACAGTTTGAGTATGG + Intergenic
905532284 1:38690497-38690519 TGGAATTTATAGATTGATTTGGG - Intergenic
908063379 1:60375413-60375435 TGGAGTCTACATAGTGAGAAGGG + Intergenic
911658881 1:100477005-100477027 TGCATTTTAAAGATGGAGTAAGG + Intronic
911795325 1:102068732-102068754 TGGACTTTAGAGATTCAGAAGGG + Intergenic
912479357 1:109968320-109968342 TTGAATCTACAGATTGAGTTGGG - Intergenic
913235070 1:116773917-116773939 CGGAATCTACAGATTGAGTTGGG - Intergenic
916091270 1:161309566-161309588 TGAATTTTACAGATGGAGTCTGG + Intronic
916164332 1:161952010-161952032 TGAAGGTTACAAATTGAGTGTGG + Intronic
917178418 1:172264891-172264913 TGTAGTTTAGAGATTAACTATGG + Intronic
918002439 1:180510093-180510115 TGGAGTTTAGAGACTCAGCAGGG - Intergenic
918673223 1:187247306-187247328 TGGAATTTACAGATTGCTTTGGG - Intergenic
922903847 1:229158985-229159007 TGGCGTTTTCACATTGAGTTAGG - Intergenic
1065685814 10:28283464-28283486 TGGTGTTTACAGATTAAGAGCGG - Intronic
1066473648 10:35723851-35723873 TGGAGATTAAAGTTTGGGTAAGG - Intergenic
1068294107 10:55045012-55045034 ATGTGTTTACAGAATGAGTATGG - Intronic
1068909545 10:62364307-62364329 TTGAGTTTATAGATTGATTTGGG - Intergenic
1069386925 10:67892130-67892152 TGGATTTTAGAGATCCAGTATGG + Intronic
1071250253 10:83810750-83810772 GGGAGTTTACAAAGTGAGAAAGG - Intergenic
1071951622 10:90709721-90709743 TGGGATTTAGAGTTTGAGTATGG + Intergenic
1072393157 10:95010173-95010195 TGGAATTTTCAAATTGAGAAAGG - Intergenic
1073275833 10:102310596-102310618 TGGGGTTTACACATTAACTATGG + Intronic
1077344857 11:2042062-2042084 TGGAGGTTGGAGAATGAGTATGG - Intergenic
1077345807 11:2051993-2052015 TGGAGTAGACAGAATGACTATGG - Intergenic
1077346736 11:2062325-2062347 TGGAGTATGGAGAATGAGTATGG - Intergenic
1077346903 11:2064164-2064186 TGGAGTATAGAGATGGAGAATGG - Intergenic
1078486960 11:11732053-11732075 TGGAGTCAACAGATTGTGTTTGG - Intergenic
1078528790 11:12120592-12120614 TGGAGTTTGTAGATTGAGAAGGG + Intronic
1079411272 11:20190129-20190151 TGGAGTATAGAGAGTGAGGAGGG - Intergenic
1080894452 11:36437600-36437622 AGGAGTTTAGAGATTGTTTAAGG + Intronic
1082184693 11:49164906-49164928 TGGACTTTACAGAGTTAGTTGGG - Intronic
1084160759 11:67348574-67348596 TGGTGTTTACTGATTGAGCAAGG + Intronic
1086460953 11:87004941-87004963 TGGAGTTAATAGATTGAATGTGG + Intergenic
1086681649 11:89680453-89680475 TGGACTTTACAGAGTTAGTTGGG + Intergenic
1086836492 11:91630677-91630699 TGGAGTTTACAATCTTAGTAAGG + Intergenic
1088722361 11:112605578-112605600 TGAAGTTTAAAGAATGAATAAGG + Intergenic
1089228617 11:116949366-116949388 TGGAGTTTAACGGCTGAGTATGG - Intronic
1091820348 12:3471295-3471317 TGGGGTTTGCAGAGAGAGTAGGG - Intronic
1092462958 12:8702220-8702242 TGGAGTTTACAGACTAATTTTGG + Intronic
1093313516 12:17620284-17620306 TGGATTTTACAAATTGATTTAGG + Intergenic
1094527534 12:31242121-31242143 TGGAGATTACACATTGACTTAGG - Intergenic
1095629818 12:44362418-44362440 TGGGGTTTATAGTTTGAATATGG - Intronic
1099645143 12:85343447-85343469 AGGAGTTTACAGTTTGGATAGGG - Intergenic
1102485605 12:113253415-113253437 TTGAGTTTGCAGTTTGAGCAGGG + Intronic
1107285726 13:38789151-38789173 TGAAGTTTACAGATTAAAGAAGG - Intronic
1108582141 13:51836860-51836882 TGGATTTTCCAGAGTGAGAAGGG + Intergenic
1111406445 13:87812876-87812898 TGGAATGTACAGATTGTCTATGG + Intergenic
1112195340 13:97220429-97220451 TGAGGTCTAAAGATTGAGTAAGG + Intergenic
1114524193 14:23358100-23358122 TGGATTTTACAGACTCAGTATGG - Intronic
1115061502 14:29196427-29196449 TTGATTTTGCAGATTGAGTTTGG + Intergenic
1115486742 14:33917726-33917748 TGGAGTTTCCAGATTCTCTAGGG - Intergenic
1115678322 14:35706911-35706933 TTGAATCTACAGATTAAGTAGGG + Intronic
1117126026 14:52627038-52627060 TTGAATTTACAGATTCATTAGGG - Intronic
1118490360 14:66253234-66253256 TGAAGTCTACACATTGTGTATGG + Intergenic
1119877347 14:78072225-78072247 TTGAGCTCACAGATTGATTATGG - Intergenic
1120663655 14:87280055-87280077 TAGAGTTTACAGCTTAATTAGGG + Intergenic
1120929055 14:89829156-89829178 TGGAGTTTAAATTTTGTGTAGGG + Intronic
1121186196 14:91972309-91972331 TGTAGTTTATAGTTTGAGAAGGG - Intronic
1124814228 15:32972627-32972649 ATGAGTCTACAGATTGACTAGGG - Intronic
1125070143 15:35545277-35545299 CTCAGTTTATAGATTGAGTATGG + Intronic
1125266181 15:37883893-37883915 TGGTGTTTAAAGATTGTGCATGG + Intergenic
1126475286 15:49059409-49059431 TGAAGTTTGTAGATTGAATAAGG - Intergenic
1126569934 15:50139997-50140019 TGGACTTTAGAGATTCAGAAGGG + Intronic
1127052907 15:55103356-55103378 TGGAGATTACTGATTGGGGATGG - Intergenic
1129950129 15:79578993-79579015 TGGAGTTTATAGCATGAGTTAGG + Intergenic
1130882123 15:88064398-88064420 TGAAGTTTGCAGCTGGAGTAAGG - Intronic
1134052450 16:11146287-11146309 TGGAGCTTACAGTTTGATAATGG - Intronic
1136399422 16:30009781-30009803 TGGAGATTACAGCTTCAGCAAGG - Intronic
1139401019 16:66681606-66681628 TGGATTTTAAAGATTTAATAGGG - Intronic
1140024567 16:71273790-71273812 TGGAATTAACAGATTGAAGATGG + Intergenic
1140417848 16:74789247-74789269 AGAAGTTTACAGAGTGAGTGAGG + Intergenic
1140531514 16:75670826-75670848 AGAAGGGTACAGATTGAGTAAGG - Intronic
1144834537 17:18150103-18150125 TGGAGTTTCCAGAGTGAGTAAGG - Intronic
1147035241 17:37675098-37675120 TGGAGTTTACAAATAGGGTGGGG + Intergenic
1148341201 17:46874537-46874559 TGGAATTTACAAATTCACTATGG - Intronic
1148561356 17:48608569-48608591 GGGAGTTTGCAGCTGGAGTAAGG - Intronic
1153759894 18:8320329-8320351 AGGAGTTAACAGATTGAGGCTGG + Intronic
1155419584 18:25640513-25640535 TCCATTTTACAGATTGAGTGGGG + Intergenic
1156505999 18:37593668-37593690 TGGATTTTACTGTTTGTGTATGG + Intergenic
1161146187 19:2679780-2679802 TGGAGTTAATACAATGAGTAAGG - Intronic
1163132847 19:15286594-15286616 TAGATTTCACAGATTTAGTAAGG - Intronic
1166846938 19:45734188-45734210 TGGAGTGCCCACATTGAGTATGG + Intronic
925687212 2:6484406-6484428 TGTGGATTACAGATTGAGAATGG + Intergenic
927848653 2:26485261-26485283 AGAAGTTTACAAATTGAATAGGG - Intronic
931828039 2:66021760-66021782 TGAAGTTTACAAATTTAGTTTGG - Intergenic
931865216 2:66402588-66402610 TTGATTTTACAGATTAAGTTGGG - Intergenic
932671717 2:73743011-73743033 TAGAGATTACAGATTTATTATGG + Intergenic
933627299 2:84615603-84615625 TTGAGTTTATAGATTGCTTATGG + Intronic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
937630808 2:124099103-124099125 TGGAGCTTACAGTGTGAGGATGG - Intronic
939117896 2:138081659-138081681 TGGGGTTTACAGATGGGGAAAGG + Intergenic
939491101 2:142877552-142877574 TGGAGATTACCGATTGGTTAGGG + Exonic
939774367 2:146366141-146366163 TTGAGTTGGTAGATTGAGTAGGG + Intergenic
941049522 2:160716654-160716676 TGGAGTTGACACCTTGAGGAAGG + Intergenic
941867415 2:170349345-170349367 AGGAATTTACAGTTTGAGTGGGG - Intronic
944050683 2:195465639-195465661 TGGATCTTAAAGATTGGGTAAGG - Intergenic
944609113 2:201382556-201382578 TGAAGTGTACAGTTTGGGTAAGG - Intronic
945951751 2:216045374-216045396 TGGATTTTGAAGACTGAGTATGG + Intronic
947628280 2:231634919-231634941 TGGAGTGGACAGACTGAGTCAGG - Intergenic
1169766783 20:9155111-9155133 TGGACTTTACAGACTCAGAAGGG - Intronic
1172292610 20:33787244-33787266 TGGAGCTTACATATCCAGTAGGG + Intronic
1173071673 20:39774208-39774230 TGGTGTTTACAGTTTGAATGTGG - Intergenic
1174478044 20:50811130-50811152 TGGAGGCTCCAGATGGAGTAGGG + Intronic
1175563160 20:59950276-59950298 TGGACTTTAGAGACTCAGTAGGG - Intergenic
1177647761 21:23921505-23921527 ATGAGTTTACAGATTGACTGGGG - Intergenic
1177846172 21:26289869-26289891 TGAATTTCACAGATTGAGTCTGG + Intergenic
949558956 3:5185460-5185482 TGGAGTTTTCTGATTGGGTATGG + Intergenic
949818357 3:8087151-8087173 TGGAGATTACAAATTGGGTCAGG - Intergenic
952118033 3:30206715-30206737 TGGAGTTTACAATGGGAGTAGGG + Intergenic
954973205 3:54669079-54669101 TGGAGTTCACAGTTTCAGGAAGG - Intronic
956285954 3:67610472-67610494 TGGGGCTTACAGATTTGGTAGGG - Intronic
956674120 3:71718872-71718894 TAGAGTTTACAGATTCAGGAGGG + Intronic
956820430 3:72949210-72949232 TGGAGTTTACAGTGGGAGGAGGG - Intronic
956911814 3:73826053-73826075 TGGAGCTTACAGTTTTATTAGGG + Intergenic
957862775 3:85977916-85977938 TAGAGTCTACAGAGTGAGTAGGG + Intronic
958116339 3:89223477-89223499 TGGAGTTTACAGCATGAGCCTGG - Intronic
958183680 3:90090943-90090965 TGGATTTTACAAATAGAGAAAGG + Intergenic
958901698 3:99894733-99894755 TGGAGTTTTCAGCTTTATTATGG - Intronic
959277632 3:104296807-104296829 TGGAGGTTACACATTGATTTTGG - Intergenic
960873292 3:122272666-122272688 TGGAGTTTTCATATGGATTAGGG - Intronic
963306733 3:143661620-143661642 TCAAGTTTACAGAGTGAGAAGGG - Intronic
964111873 3:153096303-153096325 TGGAGTTTCCAGAATGGTTAGGG - Intergenic
964567319 3:158071294-158071316 TGCAGATTAAAGAGTGAGTATGG + Intergenic
965613801 3:170572119-170572141 AGGAGTTCACAGATTTGGTATGG - Intronic
965742040 3:171885689-171885711 TGGATGTTAAAGGTTGAGTAGGG - Intronic
969784035 4:9438481-9438503 TTGAGATTACAGATTGAGCTAGG - Intergenic
971277263 4:25210144-25210166 TTGAGTTTACAGAAAGAATAGGG + Intronic
971281900 4:25248491-25248513 TGGAGGTTAGAGATTGGGTAAGG + Intronic
972326317 4:38019300-38019322 TGTTCTTTACAGATTGAATAGGG + Intronic
972824479 4:42741054-42741076 AGCAATTTACAGATTCAGTATGG + Intergenic
974251161 4:59385697-59385719 TGGAGTTATCAGAATGATTAAGG + Intergenic
980432707 4:132725394-132725416 TGGATTTTACAGTTTGGCTATGG + Intergenic
985926544 5:3023839-3023861 TGAAGTTTCCAGAGTGAGAAGGG + Intergenic
987670704 5:21003753-21003775 TTGAGATCACAGATTGGGTAGGG - Intergenic
988273714 5:29053090-29053112 CAGAGTTTACAGAATAAGTATGG - Intergenic
988689131 5:33554767-33554789 TGAATTTTACAGATTGTCTATGG - Intronic
989295490 5:39820383-39820405 TGGGGATTACAATTTGAGTATGG + Intergenic
992040940 5:72831273-72831295 TGGCTTTTACATATTTAGTAGGG + Intronic
995614127 5:113942046-113942068 TGTAGTTTTCAGATTTAGGAGGG - Intergenic
996178758 5:120392760-120392782 TGTAGCTTAAATATTGAGTAGGG + Intergenic
996739048 5:126782345-126782367 TGGGGTTTATAGATAGAGTTAGG + Intronic
997932784 5:138085904-138085926 TGGGGTATACAGATAGAATAGGG + Intronic
998856556 5:146400132-146400154 TGGAGTTTAGAGTCTAAGTAAGG - Intergenic
999871299 5:155754038-155754060 TTGAGTTTGCAGACTGTGTATGG + Intergenic
1003752238 6:9072144-9072166 TGGAATTGACAGATTGAGGATGG + Intergenic
1006742927 6:36322233-36322255 TGGAGTTCACAGGCTGAATAGGG - Intronic
1006936661 6:37723461-37723483 TGGAGCTTCCAGTCTGAGTAGGG + Intergenic
1009951661 6:70403818-70403840 TGGACTTTAGGGAGTGAGTAAGG + Intergenic
1010255659 6:73754403-73754425 TGGTGTTTAGAGACTGAGTGAGG + Intronic
1011261008 6:85469433-85469455 TGGAGCTTACATATTCAGTGGGG + Intronic
1013378237 6:109540202-109540224 TGGAGTCTACAGATGCAGTCAGG + Intronic
1013655548 6:112243068-112243090 TGGAGGGTCCAGATAGAGTAGGG + Intronic
1014602629 6:123433405-123433427 TGGAGCTTACAGTTTGACAAGGG - Intronic
1016861513 6:148723355-148723377 TGGAGATGACAGATTCAGTTTGG + Intergenic
1018453343 6:163929538-163929560 TCAAGTTTACAGATTTAGTCAGG + Intergenic
1020384428 7:7582504-7582526 TGAAGTTTTCTGATTTAGTAAGG + Intronic
1020406619 7:7842701-7842723 TGAAGAATACATATTGAGTAAGG - Intronic
1021083674 7:16393558-16393580 TGGAGTTTACAGATTGAGTAGGG - Intronic
1022548482 7:31211677-31211699 TGAAGTTTACACTTTTAGTATGG - Intergenic
1023233644 7:38060756-38060778 TGGAGTATTCTGATTGATTAGGG - Intergenic
1028003080 7:85526046-85526068 TCAATTTTACAGATTGAGAAAGG + Intergenic
1028528983 7:91817273-91817295 TGCATTTTTCAGATTGAGTGAGG - Intronic
1028843356 7:95452464-95452486 TGCAGTTTACTGATTGAGACAGG - Intergenic
1028908374 7:96179760-96179782 TGCAGTTCACAGATTAACTATGG + Intronic
1029687512 7:102158882-102158904 GGGTGTTTAGAGATGGAGTAGGG - Intronic
1030278671 7:107746278-107746300 TGAAGTTTAGAGATTGCCTAAGG + Intronic
1030536391 7:110772212-110772234 TGGAGTCTACACATTGAGAATGG + Intronic
1030889896 7:114986533-114986555 TGGAGTTTGCAGATGGTGAAAGG - Intronic
1031955029 7:127934288-127934310 TGGAGTATAAAGAGTGAGGAGGG + Intronic
1033656602 7:143379752-143379774 TGACGTTTACAGATGGAGCAGGG + Intergenic
1033986281 7:147229303-147229325 TTGAGTTAAAAGATTGACTAAGG - Intronic
1034050171 7:147975297-147975319 TGGAGTGTACTGATTGGGAAGGG + Intronic
1037838969 8:22230787-22230809 TGGAGGTGACAGATTGAAGAGGG - Intronic
1038010383 8:23471245-23471267 GGGATTTTACAGATTGATTAAGG - Intergenic
1038530266 8:28312971-28312993 TGGAATTTACTGATTAATTACGG - Intergenic
1038984894 8:32797742-32797764 TGGAGAGTACAGATTGATTATGG + Intergenic
1039635404 8:39159321-39159343 TGGTTTTTACAGATTGACTCTGG + Intronic
1040917606 8:52579523-52579545 TGGAGTTTACAGATAAACAAGGG + Intergenic
1041179377 8:55231806-55231828 TGGAGTTTACAGGATTTGTAAGG - Intronic
1042028929 8:64453406-64453428 TGGAGTTTACAGAATTAATCTGG - Intergenic
1044190715 8:89313559-89313581 TGGCTTTTACATATAGAGTAAGG + Intergenic
1046618975 8:116507555-116507577 AGGAGTCAACAGATTGGGTAGGG + Intergenic
1047831274 8:128633047-128633069 TGAAGTTTCCAGATTGAGCATGG + Intergenic
1049899895 9:149428-149450 AGGCTTTTACAGATGGAGTAGGG - Intronic
1050666409 9:7942181-7942203 TAGAGTTTCAACATTGAGTATGG + Intergenic
1050730548 9:8704266-8704288 TGGAGTTTAGGGAGTGTGTAGGG - Intronic
1050912355 9:11087648-11087670 TGCACTTTATACATTGAGTAAGG - Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1059682614 9:116600758-116600780 TGGAGTTTAAATTCTGAGTATGG - Intronic
1060224308 9:121782000-121782022 TGCAGTTTACAGCCTGAGCAAGG - Intronic
1187494056 X:19778807-19778829 TGGAGGTTGGAAATTGAGTAAGG + Intronic
1188101028 X:26088157-26088179 TGGACTTTAGAGATTCAGAAAGG + Intergenic
1191834977 X:65454521-65454543 TGGAGTCTACAGAGTCAGTCAGG - Intronic
1192777263 X:74258276-74258298 TGGCCTTTAATGATTGAGTAAGG + Intergenic
1193051695 X:77107898-77107920 TTGAGTTTACTGAGTGAGTTTGG - Intergenic
1194572046 X:95564440-95564462 TGGAATCTATAGATTAAGTAGGG + Intergenic
1195587211 X:106578741-106578763 TGGAGTCTACAGATGGAGGCAGG + Intergenic
1202032023 Y:20586239-20586261 TGGACTTTACAGATTTCCTATGG + Intronic