ID: 1021090268

View in Genome Browser
Species Human (GRCh38)
Location 7:16474625-16474647
Sequence GGTTATATTAGAACACAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021090264_1021090268 8 Left 1021090264 7:16474594-16474616 CCACCTGCAACGTGTAAGATGGT 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1021090268 7:16474625-16474647 GGTTATATTAGAACACAAGCAGG No data
1021090265_1021090268 5 Left 1021090265 7:16474597-16474619 CCTGCAACGTGTAAGATGGTTTA 0: 1
1: 0
2: 0
3: 8
4: 54
Right 1021090268 7:16474625-16474647 GGTTATATTAGAACACAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021090268 Original CRISPR GGTTATATTAGAACACAAGC AGG Intronic
No off target data available for this crispr