ID: 1021093369

View in Genome Browser
Species Human (GRCh38)
Location 7:16508710-16508732
Sequence GCAGTAGATTACCTGAAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3164
Summary {0: 1, 1: 1, 2: 21, 3: 364, 4: 2777}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021093363_1021093369 7 Left 1021093363 7:16508680-16508702 CCTGTAATCCCAGCACTTTGGGA 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623
Right 1021093369 7:16508710-16508732 GCAGTAGATTACCTGAAGTCAGG 0: 1
1: 1
2: 21
3: 364
4: 2777
1021093367_1021093369 -2 Left 1021093367 7:16508689-16508711 CCAGCACTTTGGGAGGCCAAGGC 0: 52775
1: 164492
2: 216668
3: 175886
4: 111238
Right 1021093369 7:16508710-16508732 GCAGTAGATTACCTGAAGTCAGG 0: 1
1: 1
2: 21
3: 364
4: 2777
1021093360_1021093369 26 Left 1021093360 7:16508661-16508683 CCAGGTACAATGGCTCACACCTG 0: 18
1: 1001
2: 14975
3: 51254
4: 109895
Right 1021093369 7:16508710-16508732 GCAGTAGATTACCTGAAGTCAGG 0: 1
1: 1
2: 21
3: 364
4: 2777
1021093365_1021093369 -1 Left 1021093365 7:16508688-16508710 CCCAGCACTTTGGGAGGCCAAGG 0: 84285
1: 209100
2: 236161
3: 152470
4: 88713
Right 1021093369 7:16508710-16508732 GCAGTAGATTACCTGAAGTCAGG 0: 1
1: 1
2: 21
3: 364
4: 2777

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021093369 Original CRISPR GCAGTAGATTACCTGAAGTC AGG Intronic
Too many off-targets to display for this crispr