ID: 1021093398 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:16508890-16508912 |
| Sequence | AAATTGCACCATATGTAGCC CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1021093396_1021093398 | 4 | Left | 1021093396 | 7:16508863-16508885 | CCAGGAGGGAGAGGTTTCAGTGA | 0: 6 1: 1604 2: 56930 3: 141857 4: 162392 |
||
| Right | 1021093398 | 7:16508890-16508912 | AAATTGCACCATATGTAGCCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1021093398 | Original CRISPR | AAATTGCACCATATGTAGCC CGG | Intronic | ||
| No off target data available for this crispr | |||||