ID: 1021093398

View in Genome Browser
Species Human (GRCh38)
Location 7:16508890-16508912
Sequence AAATTGCACCATATGTAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021093396_1021093398 4 Left 1021093396 7:16508863-16508885 CCAGGAGGGAGAGGTTTCAGTGA 0: 6
1: 1604
2: 56930
3: 141857
4: 162392
Right 1021093398 7:16508890-16508912 AAATTGCACCATATGTAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021093398 Original CRISPR AAATTGCACCATATGTAGCC CGG Intronic
No off target data available for this crispr