ID: 1021093398 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:16508890-16508912 |
Sequence | AAATTGCACCATATGTAGCC CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1021093396_1021093398 | 4 | Left | 1021093396 | 7:16508863-16508885 | CCAGGAGGGAGAGGTTTCAGTGA | 0: 6 1: 1604 2: 56930 3: 141857 4: 162392 |
||
Right | 1021093398 | 7:16508890-16508912 | AAATTGCACCATATGTAGCCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1021093398 | Original CRISPR | AAATTGCACCATATGTAGCC CGG | Intronic | ||
No off target data available for this crispr |