ID: 1021093861

View in Genome Browser
Species Human (GRCh38)
Location 7:16512725-16512747
Sequence TCCACGAGGTTTATGGTATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 163}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021093858_1021093861 13 Left 1021093858 7:16512689-16512711 CCAAAACGGTGGGAAATAAAATT 0: 1
1: 0
2: 13
3: 260
4: 2236
Right 1021093861 7:16512725-16512747 TCCACGAGGTTTATGGTATTTGG 0: 1
1: 0
2: 0
3: 3
4: 163
1021093857_1021093861 20 Left 1021093857 7:16512682-16512704 CCAGCTTCCAAAACGGTGGGAAA 0: 1
1: 0
2: 52
3: 552
4: 3013
Right 1021093861 7:16512725-16512747 TCCACGAGGTTTATGGTATTTGG 0: 1
1: 0
2: 0
3: 3
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021093861 Original CRISPR TCCACGAGGTTTATGGTATT TGG Intronic
900856771 1:5191867-5191889 TCCAAGGGGTTGATGATATTTGG - Intergenic
903983896 1:27210719-27210741 TCCACGAGGTTTGGGGAACTTGG - Intergenic
909734093 1:78934432-78934454 TCTAGGAGTTTTATGGTTTTGGG - Intronic
910340473 1:86181415-86181437 TTCTAGAGTTTTATGGTATTAGG + Intergenic
910929323 1:92427283-92427305 TCTAAGAGTTTTATGGTTTTTGG - Intergenic
911013907 1:93311342-93311364 TCCTCCAGTTTTGTGGTATTAGG - Intergenic
911729084 1:101273163-101273185 TCTAGGGGGTTTATGGTTTTAGG + Intergenic
912110881 1:106341274-106341296 ACCACCAAATTTATGGTATTAGG + Intergenic
912590201 1:110810603-110810625 TCTAGGAGTTTTATGGTCTTAGG - Intergenic
915843194 1:159233664-159233686 TCCACCAACTTAATGGTATTTGG - Intergenic
917195389 1:172459072-172459094 TCTAAGAGTTTTATGGTTTTAGG - Intronic
918165757 1:181945980-181946002 TCCAGGATTTTTATGGTTTTGGG - Intergenic
918805742 1:189040995-189041017 TCCAGGTTGTTTATGGCATTTGG + Intergenic
918930724 1:190853246-190853268 TCCAGGATTTTTATGGTATAAGG + Intergenic
919406831 1:197195754-197195776 TCCACTAGGTTTTTGGTATAAGG + Intronic
922708561 1:227807353-227807375 ACCACCCAGTTTATGGTATTTGG + Intergenic
1064990401 10:21251858-21251880 TCTACCCAGTTTATGGTATTTGG + Intergenic
1068055657 10:52010052-52010074 TCCATGAGTTTTATAGTTTTAGG - Intronic
1068314767 10:55325597-55325619 TCCAGGATGTTTATAGTTTTAGG - Intronic
1069754513 10:70765133-70765155 TACAGGAAGTTTATGGTACTGGG - Intergenic
1070349757 10:75580948-75580970 TCCACGGTTTTTATGGTTTTAGG - Intronic
1072479958 10:95801310-95801332 TCCAGGATTTTTATGGTTTTGGG + Intronic
1078587707 11:12608080-12608102 TCTAGGAGTTTTATGGTTTTAGG - Intergenic
1086211400 11:84324171-84324193 TCCAGGAGTTTTATAGTTTTAGG + Intronic
1086267652 11:85020572-85020594 TCCAGGATTTTTATGGTTTTAGG + Intronic
1086988921 11:93281304-93281326 GCCACCTGGTTTATGTTATTTGG - Intergenic
1088616391 11:111633765-111633787 TCCAGGACTTTTATGGCATTTGG + Intronic
1089826990 11:121286967-121286989 TCTAGGAGATTTATGATATTAGG - Intergenic
1091606538 12:1957955-1957977 TCCAGGAGGTTTATAGTCTCAGG - Intronic
1093190777 12:16072521-16072543 TCCATACGGTTTATGGCATTTGG - Intergenic
1094254295 12:28403606-28403628 GCCACCAAGTTCATGGTATTAGG - Intronic
1097970152 12:65624819-65624841 TCCACTGGGTTTATGGTGGTGGG - Intergenic
1098414536 12:70217904-70217926 TGTATGAGTTTTATGGTATTGGG - Intergenic
1099502147 12:83427142-83427164 TCCAGGATTTTTATGGTTTTGGG + Intergenic
1100776656 12:97982455-97982477 TCTAATAGTTTTATGGTATTAGG - Intergenic
1104917546 12:132273699-132273721 TAAACTAAGTTTATGGTATTTGG + Intronic
1106371061 13:29133463-29133485 TCTAAGAGCTTTATGGTTTTAGG + Intronic
1107767466 13:43752492-43752514 TCCACAAGATTTATAGTTTTAGG + Intronic
1108112563 13:47091720-47091742 TCTCCAAGGTTAATGGTATTTGG + Intergenic
1108247784 13:48534353-48534375 GCCAAGAGGTTTATCTTATTTGG + Intergenic
1108545185 13:51486537-51486559 TCCAGGAGATTAATAGTATTAGG - Intergenic
1111327880 13:86722944-86722966 TCTAGGAGTTTTATGGTTTTAGG - Intergenic
1111696602 13:91632312-91632334 CCCAAGAGATTTATGGAATTGGG + Intronic
1112631550 13:101166828-101166850 TCTAGGAGCTTTATGGTTTTAGG + Intronic
1114859430 14:26496605-26496627 TCCAGGCTGTTTATGGTTTTAGG + Intronic
1115365916 14:32556865-32556887 TCCAGGAGGTTTATCATTTTGGG + Intronic
1118504561 14:66396860-66396882 TCCAGGGGTTTTATGGTTTTAGG - Intergenic
1118804000 14:69218620-69218642 TGGACAAGGTTTATGGTTTTAGG + Intronic
1120440464 14:84530763-84530785 TCCACCAGATTTATGGGATGGGG + Intergenic
1202847625 14_GL000009v2_random:194868-194890 TCCAAGATTTTTATGGTTTTAGG - Intergenic
1126934306 15:53689094-53689116 TCCAGGATTTTTATGGTTTTAGG - Intronic
1127659663 15:61088601-61088623 GACATGAGGTTTATGGGATTTGG - Intronic
1131226771 15:90630688-90630710 TCCTCGATGATTATGGTATAAGG - Intronic
1138597487 16:58036732-58036754 TCCAGGAGATTTAAGGTCTTTGG + Intronic
1143428256 17:6857940-6857962 TCCAGGATTTTTATGGTTTTAGG + Intergenic
1147602318 17:41754250-41754272 TCCCCGAGGCTTATGGCTTTGGG - Intergenic
1149404174 17:56330025-56330047 GCCACCCAGTTTATGGTATTTGG + Intronic
1150458347 17:65326421-65326443 TCCATGAGGTTTCTGGTTTAAGG - Intergenic
1153066890 18:1055996-1056018 TCTAGGAGTTTTATGGTTTTAGG + Intergenic
1153236134 18:2990190-2990212 TCTAAGAGTTTTATGGTTTTAGG - Intronic
1165967978 19:39600409-39600431 TCCAGGATGTTTATAGTTTTGGG - Intergenic
1167869831 19:52358762-52358784 TCTAGGAGTTTTATGGTTTTAGG + Intronic
925598245 2:5579799-5579821 TCTAGGAGTTTTATAGTATTAGG - Intergenic
926995855 2:18735186-18735208 TCTAGGAGTTTTATGGTTTTAGG - Intergenic
927257410 2:21051993-21052015 TCTAAGAGGTTTATAGTTTTAGG + Intergenic
927680103 2:25133272-25133294 TCCATGAGGCTTATCGTGTTGGG - Intronic
927958377 2:27224124-27224146 TCTAGGAGGTTAAGGGTATTGGG + Intronic
928054206 2:28034841-28034863 TCTTTCAGGTTTATGGTATTTGG + Intronic
928151473 2:28833747-28833769 TCTAAGAGTTTTATGGTTTTAGG - Intronic
932630845 2:73341984-73342006 GCCACTAAGTTTATGGTAATTGG + Intergenic
933620402 2:84532384-84532406 CTCACAAGGTTTATGATATTTGG - Intronic
933980488 2:87545613-87545635 TCCACAAGTTTTATAGTTTTAGG + Intergenic
936248638 2:110850141-110850163 TCCAGAAGGTTTACGGTTTTAGG - Intronic
936313338 2:111405178-111405200 TCCACAAGTTTTATAGTTTTAGG - Intergenic
940963032 2:159806586-159806608 ACCATGAGTTTTATGGGATTAGG + Intronic
942802544 2:179892347-179892369 TCCACTTGGTTTAGGGGATTTGG - Intergenic
948619144 2:239223002-239223024 TCCATTGGGTTTAGGGTATTTGG - Intronic
1169512008 20:6274644-6274666 TCCACCCAGTTTATGGTACTTGG - Intergenic
1170197660 20:13706616-13706638 TCTTCTAGGTTTATGGTTTTAGG - Intergenic
1174967611 20:55235696-55235718 TCTAAGAGTTTTATGGTTTTAGG + Intergenic
1178738539 21:35175127-35175149 ACCACGAAGTCTATGGTATCTGG + Intronic
1182164243 22:28156501-28156523 ACCACTAAGTTTATGGTAATTGG + Intronic
1185160349 22:49223590-49223612 TCCAAGAGTTTTATAGTTTTAGG - Intergenic
951315416 3:21184303-21184325 TCAAGGAGTTTTATGGTTTTAGG - Intergenic
953544018 3:43848571-43848593 TTCTAGAGGTTTATGGTTTTGGG - Intergenic
953721386 3:45358426-45358448 TCTACGAGTTTTATAGTTTTAGG + Intergenic
957160104 3:76600155-76600177 TCCAGGGGATTTATGGTTTTGGG + Intronic
959482722 3:106893031-106893053 TCCAGGATTTTTATGGTTTTTGG - Intergenic
960000991 3:112731714-112731736 TCTACTAGGTTTATGGTGTTGGG - Intergenic
962479706 3:135787761-135787783 TCCACGAGGGTTACGTCATTTGG + Intergenic
963262659 3:143208328-143208350 ACCTCCAGGTTGATGGTATTAGG - Intergenic
963369485 3:144380068-144380090 TTCACTAGGTGTATGGTTTTGGG - Intergenic
964134110 3:153325159-153325181 TCCAGGATTTTTATGGTTTTAGG + Intergenic
964948511 3:162257121-162257143 TCCAGGACTTTTATGGTTTTAGG + Intergenic
965345906 3:167549805-167549827 TCCAGGATGTTTACGGTTTTAGG + Intronic
970047372 4:11870419-11870441 TCCACCAGGTCTCTGTTATTGGG - Intergenic
970422910 4:15921714-15921736 TGGATGAGTTTTATGGTATTAGG - Intergenic
977006668 4:91575246-91575268 TTTAGGAGGTTTATGGTTTTAGG - Intronic
977087087 4:92615032-92615054 GCCACCCTGTTTATGGTATTTGG - Intronic
981687115 4:147467038-147467060 TCCAGGATTTTTATGGTTTTAGG + Intergenic
983958438 4:173723915-173723937 TCTAGGATTTTTATGGTATTAGG + Intergenic
985258736 4:188095174-188095196 TCCAAAAGTTTTATGGTTTTCGG - Intronic
988022231 5:25635790-25635812 TCCAGGATTTTTATGGTTTTTGG + Intergenic
988672185 5:33393733-33393755 TCCAGGATTTTTATGGTTTTAGG - Intergenic
993540139 5:89139086-89139108 TCCAGAATGTTTATGGTTTTAGG + Intergenic
995628193 5:114102548-114102570 TCTACGATTTTTATGGTTTTAGG + Intergenic
995755622 5:115500770-115500792 TCCAGGAGTTTTATAGTTTTGGG + Intergenic
999564989 5:152848997-152849019 TCTAGGATGTTTATGGTTTTGGG - Intergenic
999597360 5:153219906-153219928 TCTACGATTTTTATGGTTTTGGG - Intergenic
1000769862 5:165339417-165339439 ACCAATAGATTTATGGTATTGGG - Intergenic
1003230415 6:4246793-4246815 CCTAGGAGTTTTATGGTATTGGG + Intergenic
1009377027 6:62985318-62985340 TTCAAGAGTTTTATGGTTTTAGG + Intergenic
1009802123 6:68552020-68552042 TCCAGGATTTTTATGGTTTTAGG - Intergenic
1009950044 6:70384959-70384981 TCTAGGAGTTTTATGGTTTTAGG + Intergenic
1010176273 6:73031719-73031741 TCCTGCATGTTTATGGTATTCGG + Intronic
1010615588 6:78008120-78008142 TCCTGGAGTTTTGTGGTATTAGG + Intergenic
1011741682 6:90367603-90367625 TCTAGGAGTTTTATGGTATCAGG + Intergenic
1013439552 6:110149018-110149040 TCCACAAAGTCTATGGGATTAGG + Intronic
1014136191 6:117892730-117892752 TCCACAGGGTTTAGGCTATTTGG + Intergenic
1014660344 6:124162575-124162597 TCCAGAATGTTTATGGAATTTGG + Intronic
1016988777 6:149914780-149914802 TCCAGGATTTTTATAGTATTAGG + Intergenic
1017034210 6:150252385-150252407 TCCAGGAGCTTTATGTTATGGGG - Intergenic
1021093861 7:16512725-16512747 TCCACGAGGTTTATGGTATTTGG + Intronic
1021334105 7:19377252-19377274 TGCACGATGTTTAAGGTGTTTGG + Intergenic
1022119323 7:27292201-27292223 TCCAGGATTTTTATGGTTTTAGG + Intergenic
1027911625 7:84259465-84259487 TCCATGAGGTGTAGGGAATTGGG + Intronic
1028077987 7:86538146-86538168 TCCAGGGTGTTTATGGTTTTGGG - Intergenic
1030781213 7:113602599-113602621 TCCACGGTTTTTATGGTTTTAGG - Intergenic
1036097448 8:5739700-5739722 TCCAGGATATTTATGGTTTTAGG + Intergenic
1036538642 8:9679343-9679365 TCCAAGAGGTTCATGGCATTTGG + Intronic
1041314806 8:56550143-56550165 TCCAGGATTTTTATGGTTTTAGG + Intergenic
1042838593 8:73100843-73100865 ACCACAAGGTTTAAGGTCTTAGG - Intronic
1042871306 8:73402270-73402292 TCCAGGAGTTTTATAGTTTTGGG - Intergenic
1043090256 8:75892455-75892477 TCCACCAGTTTTCTGGTATATGG + Intergenic
1043343338 8:79268670-79268692 TCCAGGATTTTTATGGTTTTAGG - Intergenic
1043514527 8:80983757-80983779 TACATCAGGTTTATGGTCTTTGG + Intronic
1047258994 8:123239568-123239590 TCCTACAGGTTTTTGGTATTTGG - Intronic
1050960272 9:11721153-11721175 TCCACCAGGCTTTTGGTATCAGG + Intergenic
1051358350 9:16260373-16260395 CCCTCGATGTTGATGGTATTAGG + Intronic
1051373627 9:16381427-16381449 TCTAGGGGGTTTATGGTTTTAGG + Intergenic
1051946458 9:22575118-22575140 TCTACCAGGGTTTTGGTATTAGG - Intergenic
1056859634 9:90168240-90168262 TCCACCAGCTTTGTGGTACTTGG + Intergenic
1057495069 9:95554025-95554047 TCCACCAGGTCTGTGGTCTTCGG + Intergenic
1058493508 9:105528660-105528682 TCCAGGATTTTTATGGTTTTAGG - Intronic
1062411429 9:136427140-136427162 ACCAAGATGTTTATGGTAATGGG - Intergenic
1186134459 X:6504616-6504638 TCCATGAGCTTTATGGTTTCAGG - Intergenic
1188282223 X:28284392-28284414 TCCAAGAGTTTTATTGTTTTTGG + Intergenic
1190151321 X:47952241-47952263 TCCAGGAGTTTTATGGTTTCAGG - Intronic
1190724927 X:53182948-53182970 TCCTCCAGTTTTATGGTTTTAGG + Intergenic
1191164790 X:57377258-57377280 TCCAGGATTTTTATGGTTTTAGG + Intronic
1192285694 X:69733212-69733234 TCCAGGGGTTTTATGGTTTTAGG + Intronic
1193437494 X:81494379-81494401 TCCACGTGTATTGTGGTATTCGG + Intergenic
1193594298 X:83427100-83427122 TCCAGGCTTTTTATGGTATTGGG - Intergenic
1193755546 X:85404823-85404845 TCTGCCAGGTTTTTGGTATTAGG + Intergenic
1196181455 X:112695431-112695453 TCTAGGAGTTTTATAGTATTGGG + Intergenic
1200335005 X:155341213-155341235 TCCAGGATTTTTATGGTTTTAGG + Intergenic
1200351462 X:155500008-155500030 TCCAGGATTTTTATGGTTTTAGG - Intronic
1200684772 Y:6248270-6248292 TCCAGGACGTTCATGGCATTGGG + Intronic
1200870935 Y:8097574-8097596 TCCAGGATTTTTATGGTTTTAGG + Intergenic
1200990302 Y:9339535-9339557 TCCAGGACGTTCATGGCATTGGG + Intronic
1200992963 Y:9359850-9359872 TCCAGGACGTTCATGGCATTGGG + Intronic
1200995617 Y:9380128-9380150 TCCAGGACGTTCATGGCATTGGG + Intronic
1200998282 Y:9400474-9400496 TCCAGGACGTTCATGGCATTGGG + Intronic
1201000790 Y:9469006-9469028 TCCAGGACGTTCATGGCATTGGG + Intronic
1201003458 Y:9489338-9489360 TCCAGGACGTTCATGGCATTGGG + Intronic
1201006114 Y:9509620-9509642 TCCAGGACGTTCATGGCATTGGG + Intergenic
1201008772 Y:9529933-9529955 TCCAGGACGTTCATGGCATTGGG + Intronic