ID: 1021095249

View in Genome Browser
Species Human (GRCh38)
Location 7:16528018-16528040
Sequence AAGTCGGATTTTAAATTAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 163}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021095249_1021095253 7 Left 1021095249 7:16528018-16528040 CCAACTAATTTAAAATCCGACTT 0: 1
1: 0
2: 1
3: 14
4: 163
Right 1021095253 7:16528048-16528070 TCTTCAAGCTACTGAAATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021095249 Original CRISPR AAGTCGGATTTTAAATTAGT TGG (reversed) Intronic
905331068 1:37198029-37198051 AAGTAAAATTTGAAATTAGTAGG + Intergenic
908153909 1:61333228-61333250 AAGTGGTATTTTGAAGTAGTTGG - Intronic
910032540 1:82746544-82746566 AACTATGATTTTAATTTAGTTGG + Intergenic
911093582 1:94037504-94037526 AAGTCTGCTTTTAGCTTAGTTGG + Intronic
913099829 1:115552840-115552862 AAATGGGATTTTAAATGAGGTGG - Intergenic
914833421 1:151187985-151188007 AAGTTCTATTTTAAACTAGTTGG + Intronic
915696669 1:157749872-157749894 AAGTGGCATTTTAAATCAGTGGG - Intronic
917534694 1:175865734-175865756 AAGTTGGATTTTATAGTAGAGGG + Intergenic
918808712 1:189086472-189086494 TAGTGGGAGTGTAAATTAGTTGG + Intergenic
919319729 1:196020693-196020715 AAGACTGATTTAAAAATAGTAGG - Intergenic
923235558 1:232029866-232029888 AACTCGGATATTAAATCAGGAGG - Intronic
923927413 1:238648422-238648444 AAGTTGGAGTGTAAATTATTTGG + Intergenic
1063758482 10:9043505-9043527 CAGTCTGATTTTCACTTAGTTGG - Intergenic
1065497597 10:26345557-26345579 AAGTAGCATTTCAAATCAGTAGG - Intergenic
1065671426 10:28123089-28123111 AGGTGGCATTTTAAATCAGTGGG - Intronic
1066964402 10:42248911-42248933 AACTGGTATTTTAAATCAGTGGG - Intergenic
1067152079 10:43744529-43744551 AAGTCTGATATTAAATTTCTAGG + Intergenic
1068086246 10:52376467-52376489 AAGTGGGATTTAAAATGAATAGG - Intergenic
1069181484 10:65365493-65365515 AAGTTGCACTGTAAATTAGTAGG - Intergenic
1071079908 10:81798571-81798593 AAGTCAGATTTTGTATTGGTGGG - Intergenic
1072762788 10:98071532-98071554 AGGTCTTATTTTTAATTAGTTGG - Intergenic
1074591169 10:114814659-114814681 AAGTGTTATTTTAAATTAGGTGG - Intergenic
1076298754 10:129407764-129407786 AAGTGGCATTTCAAATCAGTGGG + Intergenic
1076458021 10:130616969-130616991 CAGTGGGATTTCAAATAAGTGGG - Intergenic
1076576081 10:131469204-131469226 AAATGGGATTTCAAATTTGTGGG + Intergenic
1079353003 11:19708838-19708860 AAGTTGGAATTTAAAATGGTGGG + Intronic
1081828131 11:46078809-46078831 AACTCTGATTTTGAATAAGTGGG + Intronic
1087135845 11:94719132-94719154 AATTGGCATTTCAAATTAGTGGG - Intronic
1087544530 11:99567624-99567646 AAGTCAGAATTTATATTAGCAGG - Intronic
1091524032 12:1278991-1279013 AACTTGGAGTGTAAATTAGTTGG + Intronic
1093702256 12:22234955-22234977 AGGTCAGAATATAAATTAGTGGG - Intronic
1095235929 12:39795759-39795781 ACTTCTGATTTTAAATTATTGGG + Intronic
1097632783 12:62084192-62084214 AATTTGGATTTTAAAATTGTAGG - Intronic
1098074672 12:66716267-66716289 AAGTAGAATTTTTAATTAGCAGG + Intronic
1098542780 12:71676743-71676765 ATGTTTGATTTTAAATTAGATGG - Exonic
1099135630 12:78896195-78896217 AAGCAGCAATTTAAATTAGTAGG - Intronic
1099354484 12:81617091-81617113 AAGTAGGTTTTTAACTTACTAGG + Intronic
1105562011 13:21501112-21501134 AAATAGTATTTTAAATTAGTTGG - Intronic
1108641904 13:52390701-52390723 AATTCAGATTTTACAGTAGTCGG - Intronic
1109897808 13:68716488-68716510 AAGTGGCATTTCAATTTAGTTGG - Intergenic
1111169018 13:84501237-84501259 ATGTCAGATGTTAAAGTAGTAGG - Intergenic
1111504991 13:89176265-89176287 ATGTAGGATTTTAAAAGAGTTGG - Intergenic
1112517254 13:100065137-100065159 AGGTGGGATCTTAAATTATTGGG + Intergenic
1112630150 13:101152097-101152119 AAGTGGGGTTTTCAATTATTTGG + Intronic
1113504934 13:110809508-110809530 AAGTGGCATTTGAAATCAGTGGG + Intergenic
1115595712 14:34906967-34906989 AATGCAGGTTTTAAATTAGTAGG + Intergenic
1116069390 14:40024896-40024918 AAGTGGAATTTAAATTTAGTGGG + Intergenic
1116315224 14:43378831-43378853 AAGTCTGAATTTAAATTAGTGGG + Intergenic
1117101886 14:52357090-52357112 AGGTGGCATTTTAAATCAGTGGG + Intergenic
1118170907 14:63387651-63387673 AAAAAGGATTTTAAATTATTTGG - Intronic
1126510196 15:49462719-49462741 AAGTTGTATTTTAACTTAATTGG - Intronic
1131128254 15:89874898-89874920 GAGTCGTATTTTAAGTTGGTGGG + Intronic
1134403504 16:13934556-13934578 AAGCAGGTTTTTAAACTAGTTGG + Intronic
1135011173 16:18880551-18880573 AAATTTGTTTTTAAATTAGTTGG + Intronic
1135518410 16:23154514-23154536 AAGCAGCATTTTAAAGTAGTGGG - Intergenic
1135603933 16:23806996-23807018 AAGTGGTATTTCAAATAAGTGGG - Intergenic
1136314836 16:29447855-29447877 AAATTTGTTTTTAAATTAGTTGG + Intronic
1136328278 16:29549591-29549613 AAATTTGTTTTTAAATTAGTTGG + Intergenic
1136442963 16:30289614-30289636 AAATTTGTTTTTAAATTAGTTGG + Intergenic
1136730092 16:32402907-32402929 AATTGGTATTTTAAATCAGTGGG - Intergenic
1138034121 16:53585510-53585532 AAGTGGCATATCAAATTAGTGGG - Intergenic
1139284234 16:65796605-65796627 AGTTTGGATTTTAAATTAGTGGG - Intergenic
1202996305 16_KI270728v1_random:114396-114418 AATTGGTATTTTAAATCAGTGGG + Intergenic
1203022992 16_KI270728v1_random:426738-426760 AATTGGTATTTTAAATCAGTGGG + Intergenic
1143197895 17:5090372-5090394 AGGTGGCATTTTAAATCAGTAGG + Intronic
1144481469 17:15633413-15633435 AAGTAGCATTTTAAATCAGTGGG + Intronic
1144916832 17:18730309-18730331 AAGTAGCATTTTAAATCAGTGGG - Intronic
1151347703 17:73512827-73512849 AAGTAGAATTTCAAATCAGTGGG + Intronic
1153899101 18:9600011-9600033 CAGTCTGCATTTAAATTAGTGGG - Intronic
1154256282 18:12783379-12783401 CAGTCAGATCTTAAATTAGTTGG + Intergenic
1154332773 18:13443166-13443188 AAGTTGGATTTTATTTTATTTGG - Intronic
1155134474 18:22974806-22974828 AAATGGTATTTGAAATTAGTAGG + Intronic
1158825226 18:61210920-61210942 AAAATGAATTTTAAATTAGTGGG - Intergenic
1160105882 18:75975769-75975791 AATTGGGATTTTAAAAGAGTTGG + Intergenic
1161693190 19:5749463-5749485 AAGTGGGGTTATGAATTAGTTGG + Intronic
1164746160 19:30615395-30615417 AAGGTGGCTTTTAAATGAGTGGG - Intronic
929464263 2:42130679-42130701 AAGTCATATTTTAATTTAGTTGG - Intergenic
930501269 2:52221146-52221168 AATTTGGATTTCAAATTAATTGG + Intergenic
930756481 2:54978827-54978849 CAGTCAGATTTTAAATTTATGGG - Intronic
932541297 2:72656249-72656271 AAGTAGCATTTCAAATTAGTAGG + Intronic
934186399 2:89680959-89680981 AATTGGTATTTTAAATCAGTGGG - Intergenic
934315617 2:91916269-91916291 AATTGGTATTTTAAATCAGTGGG + Intergenic
934986291 2:98888281-98888303 CAGTCGTCTTTTAAATTAGAAGG - Intronic
935317110 2:101845948-101845970 AAGTGTGCTGTTAAATTAGTAGG - Intronic
935343298 2:102078430-102078452 AACTAGGCTTTTTAATTAGTTGG - Intronic
935346896 2:102116636-102116658 AAGTCTGATTTTAAATTGGGTGG + Intronic
937108710 2:119344893-119344915 AAGTGGCATCTCAAATTAGTGGG + Intronic
938897005 2:135762297-135762319 AAGTGGCATTTTTCATTAGTTGG + Intronic
939270495 2:139932288-139932310 AAGTCTGACTTGAATTTAGTAGG + Intergenic
939456593 2:142445263-142445285 AAGTTGGGGTTTAAATTAGAAGG + Intergenic
940062087 2:149583498-149583520 AAGTCGGAATTTTAATTTGTAGG + Intronic
940803546 2:158158690-158158712 AAGTTTGATTTTATTTTAGTAGG + Intergenic
940808448 2:158215148-158215170 AGGTGGCATTTTAAATCAGTGGG + Intronic
941948504 2:171127741-171127763 GAGAGGTATTTTAAATTAGTGGG - Intronic
942718723 2:178924566-178924588 AAGTTGGATTATAAATTGGGTGG + Intronic
942959469 2:181812693-181812715 AAATAGGAATTTAAATTAGGAGG - Intergenic
944765276 2:202858017-202858039 TAGTGGGAGTGTAAATTAGTTGG + Intronic
945537772 2:211040069-211040091 AGGTAGGATTTTAAATCTGTAGG + Intergenic
947495640 2:230634188-230634210 AGGTATCATTTTAAATTAGTAGG + Intergenic
1169181442 20:3572070-3572092 AAGTGGCATCTTACATTAGTGGG - Intronic
1173587531 20:44194337-44194359 AAGTTGGATTTTGAGTTACTAGG + Intergenic
1174513230 20:51071807-51071829 AAATCGGTTTTTAAAATACTTGG + Intergenic
1178640476 21:34341308-34341330 AATTCTGTGTTTAAATTAGTGGG - Intergenic
1180542388 22:16462156-16462178 AATTGGTATTTTAAATCAGTGGG + Intergenic
951950609 3:28196512-28196534 AGGTACAATTTTAAATTAGTTGG + Intergenic
956438494 3:69257502-69257524 AAGTTGAATTATAAATTTGTGGG + Intronic
957688083 3:83530083-83530105 AAATCGGATTTTACTTTATTAGG - Intergenic
958009230 3:87854807-87854829 AAGACGAGTCTTAAATTAGTAGG - Intergenic
960037137 3:113113203-113113225 AAATAGGATTTTAAATTTGGGGG + Intergenic
961582895 3:127897521-127897543 AGGTGGCATTTTAAGTTAGTAGG + Intergenic
964597703 3:158455442-158455464 AAGTTAGATTTTAAATGATTTGG - Intronic
965517956 3:169642333-169642355 AAATGGGATTTTAAAATAGTCGG + Intronic
965906638 3:173715967-173715989 GAGTTGTATTTTAAATTATTTGG + Intronic
969332208 4:6481422-6481444 AAGTGGCATTTTAAATCAGTGGG - Intronic
970331733 4:14993393-14993415 AAGTAGGATTCCAATTTAGTAGG + Intergenic
976609528 4:87015738-87015760 AATTCTGAGTTTAAATTTGTAGG + Intronic
977788446 4:101068659-101068681 AAGTCAGATTTTAAAATGGAAGG - Intronic
977947861 4:102934366-102934388 AATTGGTATTTTAAATCAGTGGG + Intronic
982048754 4:151477250-151477272 AGGTGGTATTTCAAATTAGTCGG + Intronic
983496977 4:168453508-168453530 AAGCTGGACTTTAAATGAGTTGG + Intronic
984754846 4:183315377-183315399 AAGACAGTTTTTAAACTAGTAGG - Intronic
986964062 5:13248846-13248868 AAGTCAGACTTTTAATTATTAGG - Intergenic
987948021 5:24639129-24639151 AAGGTAAATTTTAAATTAGTAGG - Intronic
988411592 5:30893043-30893065 AAGTTGAAATTTAAATTATTTGG - Intergenic
989453698 5:41617017-41617039 AAGTTGCATTCCAAATTAGTAGG - Intergenic
991179034 5:63727247-63727269 AAGGTGGATTTTAATTTATTTGG + Intergenic
992880379 5:81102727-81102749 AAGTCTGATTTCAAATATGTAGG - Intronic
993647859 5:90481556-90481578 AAGGCAGATTTTGAATCAGTTGG - Intronic
994500476 5:100570692-100570714 TAGGTGGATTTTAAAATAGTTGG + Intronic
994672121 5:102775140-102775162 AAGTGGTATTTTAAATCAATAGG - Intronic
995046769 5:107658783-107658805 AATGCAGATTTTAATTTAGTGGG - Intronic
995752492 5:115468423-115468445 CAGGAGTATTTTAAATTAGTAGG + Intergenic
995868412 5:116717866-116717888 AAGGCAGATTTTAAATCAGAAGG + Intergenic
996260687 5:121464050-121464072 AAGTGGCATTTCAAATCAGTGGG - Intergenic
996505203 5:124260880-124260902 AAGTGGGGTTTTCAATAAGTTGG - Intergenic
1004464011 6:15866463-15866485 CAATAGGATTTTACATTAGTTGG - Intergenic
1006542105 6:34748588-34748610 AAATAGGATTTCAAATTGGTAGG + Intergenic
1014903231 6:126994271-126994293 GAGTAGGAGTTTAATTTAGTAGG - Intergenic
1015730389 6:136340961-136340983 AATTGGGTTTTTATATTAGTAGG - Intergenic
1015749478 6:136545690-136545712 AAGTGGGATATAAAATTAGATGG - Intronic
1015969887 6:138733157-138733179 ATTTGGGATTTTAAATCAGTGGG + Intergenic
1017062426 6:150496968-150496990 AAGTGAGATTTAAATTTAGTGGG - Intergenic
1018600768 6:165538005-165538027 AAGAAGGATATTAAATTAATGGG - Intronic
1020966932 7:14882371-14882393 AGGTAGGATTATAGATTAGTAGG + Intronic
1021095152 7:16527172-16527194 AGGTCAGATTTCAAATTAATTGG + Intronic
1021095249 7:16528018-16528040 AAGTCGGATTTTAAATTAGTTGG - Intronic
1021683526 7:23158650-23158672 ATATAGGATTTTAAATTTGTGGG + Intronic
1022022011 7:26409319-26409341 AAGTAGCATTTTACATCAGTGGG - Intergenic
1023650343 7:42363171-42363193 AAGTGCTATTATAAATTAGTAGG - Intergenic
1024961279 7:54979526-54979548 AAGTGAGATTTCAAATTACTAGG - Intergenic
1027140854 7:75656296-75656318 AGGTGGCATTTCAAATTAGTAGG + Intronic
1028576130 7:92353154-92353176 AAGTAAGATTTTGATTTAGTAGG + Intronic
1031170131 7:118282919-118282941 ATGAAGGATTTTAAATGAGTTGG + Intergenic
1031194695 7:118598441-118598463 AACTTGGATTTTCAATTAATAGG + Intergenic
1034111387 7:148541070-148541092 CAGTAGAATTTTAAAATAGTTGG - Intergenic
1034775070 7:153818644-153818666 AAGCCAGTTTTTAAATAAGTGGG + Intergenic
1034927831 7:155137256-155137278 AAGTAGCATCTCAAATTAGTAGG - Intergenic
1037375348 8:18221331-18221353 AGCTCCAATTTTAAATTAGTTGG - Intronic
1041151005 8:54934389-54934411 AAGTCACATTTTAAATCAATTGG + Intergenic
1041449624 8:57993535-57993557 AAGTCTGAGTTTTATTTAGTTGG + Intergenic
1042158741 8:65870672-65870694 AAGTAGTATTTTAAATAACTTGG + Intergenic
1042599598 8:70485509-70485531 AATTCGTATTTTAAATTTGGGGG - Intergenic
1044129290 8:88500524-88500546 AGGTTGGATTTTAAGTTAGATGG + Intergenic
1044852386 8:96441804-96441826 AAGGTGGATTCTAATTTAGTAGG - Intergenic
1048944828 8:139435048-139435070 GAGTAGCATTTTAAATTAGCAGG + Intergenic
1051064747 9:13089202-13089224 AACTCTGCTTTTAAATTATTGGG - Intergenic
1055634749 9:78265406-78265428 CAGTCAGATTTTCAATTACTAGG + Exonic
1060237981 9:121879501-121879523 AAGTCAGATTTTGAGTTAGAAGG + Intronic
1060536530 9:124393641-124393663 AAGTGGTGTTTTAAATTATTAGG - Intronic
1185741614 X:2537569-2537591 ATTTCGGATTTCAAATAAGTAGG + Intergenic
1188808741 X:34624917-34624939 TAGTCTGATTTTAACTTATTGGG + Intergenic
1189605003 X:42667754-42667776 AAGTTGGATTTTAAATTGTAAGG - Intergenic
1191833144 X:65436484-65436506 AGGTCGGCATTTAAATTGGTGGG - Intronic
1193956078 X:87864636-87864658 AAGTCAGCTTTTAAATAACTGGG + Intergenic
1194029327 X:88791768-88791790 AAGTTGGATTTTTAAAAAGTTGG - Intergenic
1195042434 X:101026737-101026759 TAGTAGGATTTTCACTTAGTAGG - Intronic
1196204304 X:112921730-112921752 GAATTGCATTTTAAATTAGTTGG + Intergenic
1197683789 X:129416255-129416277 AAGTAGCATTATAAATTAGTTGG + Intergenic
1201381242 Y:13381983-13382005 AAGTGGGTTTTTTAATTAGTAGG - Intronic