ID: 1021101961

View in Genome Browser
Species Human (GRCh38)
Location 7:16594510-16594532
Sequence CAGTCTGCCAGCCTGTTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021101961_1021101964 -7 Left 1021101961 7:16594510-16594532 CCACAGAACAGGCTGGCAGACTG No data
Right 1021101964 7:16594526-16594548 CAGACTGACAGGCCTTTGTTGGG No data
1021101961_1021101963 -8 Left 1021101961 7:16594510-16594532 CCACAGAACAGGCTGGCAGACTG No data
Right 1021101963 7:16594525-16594547 GCAGACTGACAGGCCTTTGTTGG No data
1021101961_1021101967 18 Left 1021101961 7:16594510-16594532 CCACAGAACAGGCTGGCAGACTG No data
Right 1021101967 7:16594551-16594573 TTTTTTTGGTCTGTAGCTGTTGG No data
1021101961_1021101965 4 Left 1021101961 7:16594510-16594532 CCACAGAACAGGCTGGCAGACTG No data
Right 1021101965 7:16594537-16594559 GCCTTTGTTGGGACTTTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021101961 Original CRISPR CAGTCTGCCAGCCTGTTCTG TGG (reversed) Intergenic
No off target data available for this crispr