ID: 1021106508

View in Genome Browser
Species Human (GRCh38)
Location 7:16645280-16645302
Sequence GAGGGGTAGTTACAGAGGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 4, 3: 43, 4: 249}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021106508 Original CRISPR GAGGGGTAGTTACAGAGGCT CGG (reversed) Intronic
900276590 1:1833627-1833649 CACGTGGAGTTACAGAGGCTGGG + Intronic
900569786 1:3352538-3352560 GAGGCTTAATCACAGAGGCTGGG - Intronic
901348030 1:8565046-8565068 GAGAAGTGGTTACAGAGGCTGGG + Intronic
902874084 1:19330636-19330658 GAGGGGCAGGTACAGAGGCCTGG + Intergenic
904306314 1:29592459-29592481 GAGGGGTAGGGGCAGAGGCAAGG + Intergenic
904368997 1:30036658-30036680 GATGGGAAGTTACAGATGATGGG - Intergenic
904859595 1:33525524-33525546 GAATGATGGTTACAGAGGCTGGG + Intronic
906142188 1:43540432-43540454 GAACGGCAGGTACAGAGGCTTGG + Intronic
907569320 1:55468349-55468371 GGGGTGTAGGTACAGTGGCTTGG + Intergenic
908269945 1:62412627-62412649 GACAAGTAGTTGCAGAGGCTGGG - Intergenic
909564206 1:77036903-77036925 GAGAGGTAGTTACAGTAGGTGGG + Intronic
910703421 1:90101469-90101491 GAGGGTTAGTTGCAGAATCTGGG + Intergenic
910941928 1:92545869-92545891 GAGGCGTATATGCAGAGGCTTGG - Intronic
912500516 1:110119050-110119072 GAGGGGTTTATACAAAGGCTTGG + Intergenic
913374834 1:118139769-118139791 GAATGGTGGTTACAGAGACTGGG + Intronic
913522520 1:119659185-119659207 TTGGTGTAGTTACACAGGCTTGG - Intergenic
915272665 1:154766239-154766261 GAGGACTAGTTAGAGAGGATAGG - Intronic
916940979 1:169677398-169677420 GAGGGGTAGCAACTGGGGCTGGG + Intronic
917736337 1:177924118-177924140 AAGGGGAAGTGAAAGAGGCTAGG + Intronic
917850863 1:179062839-179062861 GAGGGGTAGGTATAGAGGAAGGG - Intronic
918108711 1:181436679-181436701 CAATGGTGGTTACAGAGGCTGGG + Intronic
918613005 1:186513334-186513356 GAGGGGCTGTAACTGAGGCTGGG + Intergenic
919858852 1:201725040-201725062 GGAGGGTAGCTGCAGAGGCTGGG - Intronic
921457269 1:215387107-215387129 GAAGGATGCTTACAGAGGCTGGG + Intergenic
921899608 1:220436459-220436481 GAGGGGTACCCTCAGAGGCTTGG + Intergenic
922144499 1:222926076-222926098 GAGGGGTGGAGACAGAGGATGGG - Intronic
922155498 1:223037401-223037423 GACAGGAAGGTACAGAGGCTGGG + Intergenic
923195838 1:231666626-231666648 GAGGGGTGGGCAGAGAGGCTGGG - Intronic
923868859 1:237969426-237969448 AAGGGGTAGTTCTAGATGCTGGG + Intergenic
1063641185 10:7832211-7832233 GAACAGTGGTTACAGAGGCTGGG - Intronic
1064432481 10:15283126-15283148 GAGAGGGAGTTACAGAGGGAGGG + Intronic
1065508539 10:26454548-26454570 GAAGGATGGTTACCGAGGCTGGG + Intronic
1067071085 10:43132539-43132561 GTGTGGTAGTCACAGTGGCTGGG - Intergenic
1069090343 10:64192882-64192904 GAGTGGTAGTTTAGGAGGCTGGG + Intergenic
1069255316 10:66324586-66324608 GATGGGCAGGTGCAGAGGCTGGG - Intronic
1069754385 10:70764255-70764277 GAGGGGAAGGCACAGAGCCTGGG + Intergenic
1070040881 10:72778497-72778519 GAATGGTAGTTACAGAGGCTGGG + Intronic
1070855210 10:79603121-79603143 GATGGGCAGGTTCAGAGGCTGGG + Intergenic
1071192347 10:83116017-83116039 GAGGGTTAGTTTCTGGGGCTGGG - Intergenic
1072359871 10:94648855-94648877 GAATGGTGGTTACAGAGGCTGGG - Intergenic
1072799941 10:98385758-98385780 GAAGGGTAGGCACAGAGGCCAGG - Intronic
1073089946 10:100927266-100927288 GAAGGGTAGTTGCTGAGGGTGGG - Intronic
1074226279 10:111487652-111487674 GAAGGATTGTAACAGAGGCTGGG - Intergenic
1074583754 10:114746255-114746277 GAATGGTGGTTACTGAGGCTGGG - Intergenic
1074792082 10:116899480-116899502 GAAGGGAAGTTAGAGTGGCTGGG + Intronic
1074959359 10:118426645-118426667 GAATGGTGGTTACAGAGGCTGGG - Intergenic
1075615217 10:123885674-123885696 GAGTGGTAGCTGCAGTGGCTGGG + Intronic
1075703478 10:124484206-124484228 GTGGGGCAGCTTCAGAGGCTGGG + Exonic
1076764211 10:132624300-132624322 GAGCGGTTCTTACAGAGGCCTGG + Intronic
1077939165 11:6821724-6821746 GAATGGTGGTTACAGAGGCTGGG + Intergenic
1080204678 11:29714931-29714953 CAGTGGTGGTTACAGAGGCTGGG - Intergenic
1080539634 11:33254048-33254070 GAGGGGTTTTTGAAGAGGCTAGG + Intergenic
1081664729 11:44910139-44910161 GAGGGGATGATACAGACGCTAGG + Intronic
1081865434 11:46357233-46357255 GAGGGGCTGTCTCAGAGGCTTGG - Intronic
1082608298 11:55269268-55269290 GAGCGCTAGATTCAGAGGCTGGG - Exonic
1083283022 11:61639098-61639120 CCGGGAGAGTTACAGAGGCTGGG + Intergenic
1083820965 11:65171219-65171241 GAGGGGTGGGTGCAGAGACTTGG - Intronic
1084470178 11:69354873-69354895 GAAGGGTGGTTACTGGGGCTGGG + Intronic
1085115840 11:73930817-73930839 GAATGGTGGTTACAGAGACTCGG + Intergenic
1085802414 11:79602590-79602612 GAGGGGTGGGTACAGATCCTAGG + Intergenic
1088235241 11:107716427-107716449 GAATGGTGGTTACAGAGGCTGGG + Intronic
1088584490 11:111349974-111349996 GAATGGTAGTTATAGAGGCTGGG + Intergenic
1088920076 11:114254291-114254313 CAGGGGTAGGTAGGGAGGCTGGG + Intergenic
1089959967 11:122607755-122607777 GAATGGTGGTTATAGAGGCTGGG + Intergenic
1093323917 12:17749227-17749249 GAGTGGTAGTAAAAGAGCCTGGG + Intergenic
1099422172 12:82474268-82474290 AAGATGGAGTTACAGAGGCTAGG + Intronic
1100428683 12:94510780-94510802 GAATGGTAGTTACAGGGGCTAGG - Intergenic
1101025517 12:100600628-100600650 GAGTGATTGTTACAGATGCTGGG + Intronic
1102013045 12:109630820-109630842 GAGGGGAATATACAGAGGATAGG + Intergenic
1102441340 12:112966055-112966077 GAGGGGGAAATACAGAGGCAGGG + Intronic
1103049532 12:117767503-117767525 GAAGTCTAGTTAAAGAGGCTGGG + Intronic
1103399765 12:120635783-120635805 GAGGACTAATTTCAGAGGCTGGG - Intergenic
1104717965 12:131029304-131029326 GAGGGGGAGGCACAGAGGCTGGG - Intronic
1104778925 12:131407350-131407372 GAGGGGCAGGAACGGAGGCTGGG - Intergenic
1106186739 13:27416219-27416241 GAGGGCTAATTAGAGAAGCTGGG + Intergenic
1106535609 13:30639861-30639883 GAAGGGTAGTGACTCAGGCTGGG - Intronic
1107181572 13:37467259-37467281 GAGGGGAAGTCACAGGGGCCAGG - Intergenic
1107974956 13:45679938-45679960 GATGGGCAGGTGCAGAGGCTGGG + Intergenic
1108498987 13:51051697-51051719 GAGGAGTGGGTGCAGAGGCTGGG - Intergenic
1109048762 13:57449661-57449683 ACGGGGTAGCTACAGAGCCTAGG + Intergenic
1109660213 13:65447953-65447975 GAATTGTAGTTACAGAGGCTTGG + Intergenic
1109801192 13:67380522-67380544 GATGGGCAGGTGCAGAGGCTGGG - Intergenic
1111172527 13:84546449-84546471 GAATGGAGGTTACAGAGGCTGGG - Intergenic
1112717562 13:102204387-102204409 GAGGTGTGGTTACAGTGGGTGGG - Intronic
1114257138 14:21012728-21012750 GAGGGGTAGGGACAGAGGACAGG - Intergenic
1114666058 14:24377776-24377798 GAGTGGTGGCTACAGAAGCTTGG + Exonic
1114783289 14:25564370-25564392 GAAGGATGGTTACAGAGGCTTGG - Intergenic
1116458375 14:45144334-45144356 GAAGGATGATTACAGAGGCTGGG - Intronic
1116901997 14:50370510-50370532 GAATGGTGGTTACAGAGGCTAGG - Intronic
1119273173 14:73327925-73327947 GATCAGTAGTTGCAGAGGCTGGG - Intronic
1120415596 14:84215080-84215102 GATGGGCAGGTGCAGAGGCTGGG + Intergenic
1124000196 15:25752468-25752490 GAATTGTGGTTACAGAGGCTGGG + Intronic
1124000252 15:25753259-25753281 GAACTGTGGTTACAGAGGCTGGG - Intronic
1126519099 15:49569790-49569812 GAGCAGTAGTTACAGAGGCTGGG - Intronic
1127849393 15:62899802-62899824 GAGGGGTAATTTCAGGTGCTTGG - Intergenic
1128869904 15:71146743-71146765 GAGTGGTAGGCATAGAGGCTAGG + Intronic
1128911574 15:71520206-71520228 GAGGGGTTGTCAGAGAGGGTTGG + Intronic
1129339571 15:74876379-74876401 GAGGGGTGGCCATAGAGGCTTGG - Intergenic
1129784315 15:78299151-78299173 GACGGGTACAGACAGAGGCTGGG - Intronic
1129896337 15:79109908-79109930 GAATGGTAGTTACAGAGGCCAGG + Intergenic
1129942423 15:79510004-79510026 GAGGGGCAGATCCAGAGGATAGG - Intergenic
1131105496 15:89731389-89731411 GATGGGTAGGTGCAGAGTCTGGG + Intronic
1132195549 15:99912218-99912240 GAGGGGTAAGGAAAGAGGCTGGG - Intergenic
1134881670 16:17750103-17750125 GAAGGGTAGTGGCAGAGGGTGGG + Intergenic
1135636983 16:24086079-24086101 CATGGCCAGTTACAGAGGCTGGG + Intronic
1136139053 16:28277072-28277094 GTGGGGTCGTTACGCAGGCTGGG + Intergenic
1138348252 16:56332896-56332918 GCGGGGCAGGCACAGAGGCTTGG + Intronic
1138524277 16:57592916-57592938 GAGGGGAAGTGGCACAGGCTTGG + Intergenic
1139044740 16:63042953-63042975 GACTGGTGGTTACAGAGGCTGGG - Intergenic
1143435860 17:6924456-6924478 GAATTGTGGTTACAGAGGCTGGG - Intronic
1143702096 17:8668257-8668279 GAATGTTGGTTACAGAGGCTGGG - Intergenic
1144329208 17:14209086-14209108 GAATGGTGGTTAGAGAGGCTGGG - Intergenic
1145301813 17:21646232-21646254 AAGGGGAAGTTACAGGGGCTGGG - Intergenic
1145328154 17:21848978-21849000 AAGGGGAGGTTACAGGGGCTGGG - Intergenic
1145348499 17:22057087-22057109 AAGGGGAGGTTACAGGGGCTGGG + Intergenic
1145694939 17:26780325-26780347 AAGGGGAGGTTACAGGGGCTGGG - Intergenic
1146102027 17:29992145-29992167 GAATGGTGGTTACAGAGGCTGGG - Intronic
1148468826 17:47880892-47880914 GGGGGGTTGTGGCAGAGGCTGGG - Intergenic
1148776384 17:50097758-50097780 GAGGGCTAGACACAGAGACTAGG - Intronic
1149084704 17:52701419-52701441 GATGAGTGGTGACAGAGGCTTGG + Intergenic
1149533685 17:57415798-57415820 GAGGGGTGGGGGCAGAGGCTGGG - Intronic
1152375444 17:79916287-79916309 GAGGGGCTGGTCCAGAGGCTGGG + Intergenic
1203192763 17_KI270729v1_random:205166-205188 AAGGGGAGGTTACAGGGGCTGGG - Intergenic
1203202127 17_KI270730v1_random:4601-4623 AAGGGGAGGTTACAGGGGCTGGG - Intergenic
1155763856 18:29602940-29602962 GAAGGATAGTTACCAAGGCTGGG + Intergenic
1157855452 18:51100770-51100792 GATGGGCAGGTGCAGAGGCTGGG - Intergenic
1159846460 18:73466922-73466944 GAAGGGTGGTTACAGAGGCTAGG + Intergenic
1160934388 19:1586447-1586469 GACGCGTAGTGCCAGAGGCTGGG + Intronic
1162652741 19:12103288-12103310 GAGAGGGTGATACAGAGGCTTGG - Intronic
1162966405 19:14158263-14158285 GAGGGGCAGGTACACAGCCTGGG + Intronic
1163273296 19:16267002-16267024 GAGGGTTAGTTGCAGAAGATGGG + Intergenic
1163676737 19:18659166-18659188 GAGAGGGAGTGACAGAGACTTGG - Intronic
1164508684 19:28880058-28880080 GAAGGATGGTTACAGGGGCTGGG - Intergenic
1167323027 19:48807811-48807833 GAGGGGCAGCTACAGGGGCCTGG + Intronic
1167348793 19:48962705-48962727 GTGGGGTGGGAACAGAGGCTCGG - Intergenic
926394111 2:12423841-12423863 GATGGGCAGATGCAGAGGCTGGG - Intergenic
926972851 2:18484195-18484217 GAGGGGTAATCACAGAGTCACGG + Intergenic
927193880 2:20534672-20534694 GATTGGTAGGTGCAGAGGCTGGG + Intergenic
927895555 2:26779466-26779488 GAGGGGTATTTCCAGTGGATGGG - Exonic
929549666 2:42881438-42881460 GAAGGGTAATTACTGAGGCAGGG - Intergenic
930540095 2:52694866-52694888 GAGTGGTGGTAACAGAGGTTGGG + Intergenic
930747692 2:54901742-54901764 GAGGAGTTGGTAAAGAGGCTCGG + Intronic
931289559 2:60860560-60860582 GATGAGTAGTTGCAGGGGCTGGG - Intergenic
931451544 2:62371107-62371129 GAGGGTCAGATTCAGAGGCTGGG + Intergenic
932995449 2:76845845-76845867 GAGGGGAAGTTTCAGAAGCTAGG + Intronic
933033846 2:77367210-77367232 GAGGGGCATTCACAGAGGTTAGG - Intronic
935152688 2:100451722-100451744 CAGGGGAAGGTTCAGAGGCTTGG - Intergenic
935543494 2:104376596-104376618 GAGGGGTGGGCACAGAGCCTAGG + Intergenic
936391560 2:112079282-112079304 GAATGGTGGGTACAGAGGCTGGG - Intronic
936988462 2:118335387-118335409 GAATGGTAGCTACAGAGGCTGGG - Intergenic
937627320 2:124057737-124057759 GAAGGATGGTAACAGAGGCTGGG + Intronic
937989870 2:127656340-127656362 GCGGGGCAGGAACAGAGGCTGGG - Intronic
938079840 2:128364065-128364087 GATGGGTAGTGAGAGAGGCTGGG + Intergenic
939040336 2:137181567-137181589 GAGGCATATTTACAGAGGCTGGG + Intronic
940180628 2:150928466-150928488 GAATGGTGGTTACAGAGGCTGGG + Intergenic
942192362 2:173482854-173482876 GAATGATGGTTACAGAGGCTGGG - Intergenic
942700125 2:178698207-178698229 GAATGATGGTTACAGAGGCTGGG + Intronic
945604510 2:211911726-211911748 GATTGGTGGTTACAGAGACTGGG + Intronic
947304595 2:228730127-228730149 GAGTGGTGGTTACAAAGGCTGGG - Intergenic
947705302 2:232270049-232270071 GAGGGGCAGGATCAGAGGCTAGG + Intronic
948046196 2:234947324-234947346 CTGGGGAAGTTACAGAGGATGGG + Intergenic
948444033 2:238018176-238018198 GGGAGGTGGTTCCAGAGGCTTGG + Intronic
1169140502 20:3224778-3224800 GTGGGGTGGGTACATAGGCTTGG + Intergenic
1169262932 20:4150688-4150710 GGGGGTTAGGTAGAGAGGCTGGG - Intronic
1171356456 20:24549531-24549553 GAAGGGCAGGTGCAGAGGCTGGG + Intronic
1171518386 20:25757620-25757642 AAGGGGTGGTTACAGGGGCTGGG - Intergenic
1171558469 20:26098586-26098608 AAGGGGAGGTTACAGGGGCTGGG + Intergenic
1171779789 20:29408593-29408615 GAGGGATAGCAACAGAGCCTTGG - Intergenic
1171820802 20:29836096-29836118 GAGGGGGAGCAACAGAGCCTTGG - Intergenic
1172613250 20:36266941-36266963 GAGAGGTAGTTTCTGAGGCCAGG - Intronic
1173596540 20:44262209-44262231 GAGGGGAGGTGACAGAGGGTGGG + Intronic
1173936164 20:46866796-46866818 GAAGAATTGTTACAGAGGCTGGG - Intergenic
1174528171 20:51190183-51190205 GAGGGGCAGTCACAGGGGCCAGG - Intergenic
1176225944 20:63999423-63999445 GCGGGGAGGCTACAGAGGCTTGG + Intronic
1177344707 21:19854184-19854206 GAGGGGTTGCGACAGAGCCTGGG + Intergenic
1180324838 22:11361039-11361061 GAGGGGGAGCAACAGAGCCTTGG - Intergenic
1183215082 22:36474206-36474228 GAGGGCTGTTTACAGGGGCTGGG - Intronic
1184920245 22:47600742-47600764 GAGGGGTGTTCACAGAGGCTGGG - Intergenic
1184968751 22:48000124-48000146 GAATGGTGGTTACAGAGTCTGGG - Intergenic
949628383 3:5893794-5893816 AAATGATAGTTACAGAGGCTGGG - Intergenic
950645925 3:14376774-14376796 TGGGGGTAGCTACAGAGGCCTGG - Intergenic
951986930 3:28631485-28631507 GACGGGTGCTTCCAGAGGCTGGG - Intergenic
956128522 3:66033753-66033775 GAGGGATAGTTACAGTTCCTGGG + Intronic
956181094 3:66518842-66518864 GATGGGCAGGTACAGAGGCTGGG + Intergenic
957085340 3:75672031-75672053 GAGGGGGAGCAACAGAGCCTTGG + Intergenic
957170118 3:76727715-76727737 GAATGCTAGATACAGAGGCTAGG + Intronic
959180493 3:102973290-102973312 GAATAGTAGTTACAGAGGATGGG - Intergenic
960220263 3:115099563-115099585 GAGGGGTAGTTGCTGAGGGTGGG - Intronic
960597976 3:119423998-119424020 GGATGGTAGTTACAGAGGCTGGG - Intergenic
962276173 3:134015412-134015434 GAATGATGGTTACAGAGGCTGGG + Intronic
964228285 3:154432444-154432466 GTGGGCTAGTTACAGAAGGTGGG - Intergenic
964269344 3:154939062-154939084 GATGGCTAGCTACAGACGCTTGG + Intergenic
964319306 3:155478222-155478244 GTAGGATAGTTACATAGGCTGGG + Intronic
964881700 3:161430561-161430583 GGGGGGATGTTACACAGGCTGGG - Intergenic
964961539 3:162433952-162433974 GAAGGATAGTTAAAGAGCCTGGG + Intergenic
968005249 3:195238252-195238274 GAGAGGTAATTACAGACGGTGGG - Intronic
968311815 3:197689969-197689991 GAGTGATAGTTACAGAGGCTGGG - Intronic
971035013 4:22683535-22683557 GAGGGGTAGGGGCATAGGCTTGG - Intergenic
971811608 4:31435103-31435125 GAATGGTGGTTACAGAGGCTGGG + Intergenic
973004280 4:44989641-44989663 GAGGGGAAGTTTCTGGGGCTGGG - Intergenic
975649299 4:76576479-76576501 GAAGGATGGTTACAGAGGCTGGG + Intronic
976029427 4:80733626-80733648 GAGGAATGGTCACAGAGGCTGGG - Intronic
977077130 4:92468909-92468931 GAGAGGTAGTTCCAGAGACAAGG + Intronic
979365648 4:119819588-119819610 GAATGCTGGTTACAGAGGCTGGG - Intergenic
979802357 4:124926912-124926934 GATGGGCAGGTACAGAGGCTAGG + Intergenic
979828032 4:125264664-125264686 GAATGATAGATACAGAGGCTGGG - Intergenic
979982731 4:127276478-127276500 GAGAGGGTGATACAGAGGCTTGG - Intergenic
981686815 4:147463894-147463916 GAATGGTGGTTACAAAGGCTAGG + Intergenic
982064669 4:151643604-151643626 GAATGGTGGTTACAGAGGCTGGG - Intronic
982401696 4:154975108-154975130 GAAGGATAATTAAAGAGGCTGGG - Intergenic
985034044 4:185820571-185820593 GAGGGACAGGGACAGAGGCTAGG + Intronic
985230082 4:187806284-187806306 GAAGGATGGTTACAGAGGCTGGG + Intergenic
985840945 5:2305322-2305344 GAGGGGTGGAGACAGAGGGTCGG + Intergenic
986360938 5:6977609-6977631 GAGGTGGAGATGCAGAGGCTGGG - Intergenic
986369202 5:7063138-7063160 GAGGGATAGTGAGAGAGGTTGGG + Intergenic
986662155 5:10068952-10068974 GAAGGGTGGTTGCAGGGGCTGGG - Intergenic
987937826 5:24491052-24491074 GTGGTGTAGTAACAGAGTCTGGG - Intronic
988870456 5:35384379-35384401 GAAGGGAAGTCACAGAAGCTGGG + Intergenic
989393575 5:40928226-40928248 GAATGGTGGTTACAGAGACTGGG + Intronic
989421382 5:41242972-41242994 GAATGGTGGTTGCAGAGGCTGGG + Intronic
989491492 5:42060576-42060598 GATGGGCAGGTACAGAGGCCAGG - Intergenic
989685417 5:44080900-44080922 GAGGAGTAGATTCAGAAGCTGGG + Intergenic
991665151 5:68992312-68992334 GTACTGTAGTTACAGAGGCTAGG - Intergenic
992249344 5:74861930-74861952 GAGGGATAGTTACTTAGGCTTGG - Intronic
992954978 5:81899154-81899176 GAATGGTGGTTACAGAAGCTGGG + Intergenic
993327110 5:86554094-86554116 GAATGGTGGTTACCGAGGCTAGG + Intergenic
996971114 5:129369106-129369128 GAGGGTCAGTTACATAGGCATGG - Intergenic
998725437 5:145007764-145007786 GAATGGTGGTTACAGGGGCTGGG + Intergenic
999504651 5:152182159-152182181 CAGGGGCAGGCACAGAGGCTGGG - Intergenic
999625385 5:153515450-153515472 GAATGGTGGTTGCAGAGGCTGGG + Intronic
1001768525 5:174274345-174274367 GAGGAGTGGTTACAGAGGATTGG - Intergenic
1002521394 5:179794893-179794915 CTGGGGTAGTTGCAGAGGGTGGG - Intronic
1004780978 6:18908294-18908316 GATGGGAAGTTACAGAGTTTAGG - Intergenic
1004908986 6:20264584-20264606 GAATGGTGGTTACAGAGGCTAGG + Intergenic
1006187377 6:32189115-32189137 GAGGGAGAGAGACAGAGGCTGGG + Intronic
1006574178 6:35031819-35031841 GAAGGCCAGTTATAGAGGCTGGG - Intronic
1006687624 6:35850033-35850055 GAATGGTGGTTACAGAGACTGGG + Intronic
1008322538 6:50134541-50134563 TTGGGGTAGTTGCAGAGGCCAGG - Intergenic
1008858556 6:56121188-56121210 GAAGGATGGTTACAGAGGCTGGG + Intronic
1008977313 6:57442945-57442967 AGAAGGTAGTTACAGAGGCTGGG - Intronic
1009165449 6:60335896-60335918 AGAAGGTAGTTACAGAGGCTGGG - Intergenic
1009468471 6:64002562-64002584 GATGGGCAGGTACAGAGGCTAGG - Intronic
1010103142 6:72133850-72133872 GAAAGATAGTTACAGAGGGTGGG + Intronic
1010426028 6:75729686-75729708 GTGGGGTCATTCCAGAGGCTGGG + Intergenic
1010572746 6:77497541-77497563 GAAGGGTAGGTAAACAGGCTAGG - Intergenic
1011085041 6:83530365-83530387 AAGGTGTAGCTACAGAAGCTTGG - Intergenic
1011549285 6:88514942-88514964 GAGGGGGAGTTAGAGAGCCCAGG - Intergenic
1012220644 6:96644959-96644981 CAATGGTGGTTACAGAGGCTGGG - Intergenic
1014862457 6:126486194-126486216 AAATGGTAGTTACAGAGGCTGGG - Intergenic
1015140785 6:129929105-129929127 GAGGGGTGGTTATACAGACTCGG - Intergenic
1016762508 6:147753719-147753741 GAAAGATGGTTACAGAGGCTGGG - Intergenic
1017300015 6:152846170-152846192 GAATGGTGGTTGCAGAGGCTGGG + Intergenic
1017629872 6:156386394-156386416 GAATGGTGGTTACAGAGACTGGG + Intergenic
1018411858 6:163557512-163557534 GAGCGATGGTTCCAGAGGCTGGG + Intronic
1018493213 6:164318778-164318800 AAATGGTGGTTACAGAGGCTAGG - Intergenic
1019581873 7:1768478-1768500 GAAGGCTGGTTGCAGAGGCTCGG - Intergenic
1019939491 7:4278002-4278024 GAAGGGAAGACACAGAGGCTGGG - Intergenic
1021106508 7:16645280-16645302 GAGGGGTAGTTACAGAGGCTCGG - Intronic
1021726818 7:23555262-23555284 GAATGGTGGTTACAGAGGCCAGG - Intergenic
1022344168 7:29497879-29497901 GAATGGTAGTTACAGGGGATGGG + Intronic
1022625209 7:32028856-32028878 GAATGGTGGCTACAGAGGCTGGG - Intronic
1023693351 7:42817112-42817134 GAATAGTGGTTACAGAGGCTGGG + Intergenic
1025923222 7:65934546-65934568 GAATGGTGGTTATAGAGGCTGGG - Intronic
1026372304 7:69713426-69713448 GAATAGTAGTTACTGAGGCTGGG - Intronic
1033646134 7:143305852-143305874 GAGAGGTGGTTACAGAGTCTAGG - Exonic
1034265414 7:149778241-149778263 TGGGGGTAGTTGCAGAGGGTCGG - Intergenic
1035042793 7:155942738-155942760 GAGGGGCTGTCACAGGGGCTCGG + Intergenic
1035219443 7:157397153-157397175 AAGGGGTAGCTACAGACGCACGG - Intronic
1037753477 8:21697147-21697169 GAGGGGAAGGGACAGAGGATAGG + Intronic
1039646760 8:39293230-39293252 GAATGGTGGTTACAGAGGCTGGG - Intergenic
1040554927 8:48469911-48469933 AAGGAGTCATTACAGAGGCTCGG + Intergenic
1040714448 8:50231691-50231713 GAAAGGTGGTTACAAAGGCTGGG + Intronic
1041727860 8:61034537-61034559 GAATGGTGATTACAGAGGCTCGG - Intergenic
1042628120 8:70782590-70782612 GAATGGTGGTTACAGAGGTTAGG - Intronic
1042874464 8:73428139-73428161 CAGTGGTGGGTACAGAGGCTGGG - Intronic
1043580020 8:81701228-81701250 GGGCGGTAGTTACAGAAGGTTGG - Intergenic
1043612628 8:82083932-82083954 GAAGGATGGTTCCAGAGGCTGGG - Intergenic
1044826690 8:96205221-96205243 GAATGGTGATTACAGAGGCTAGG - Intergenic
1046269027 8:111868864-111868886 GAATGGTGGTTACAGAAGCTAGG + Intergenic
1046917360 8:119691905-119691927 GATGGGTAGTGGCAGAGCCTAGG + Intergenic
1047250439 8:123178258-123178280 GAGGAGTAGTTACAGTCACTTGG + Intergenic
1047690378 8:127346737-127346759 GAATGCTGGTTACAGAGGCTGGG - Intergenic
1049344582 8:142131685-142131707 CAGGGGTAGTGGCAGTGGCTGGG + Intergenic
1050934630 9:11379904-11379926 GATGGGCAGTTGCAGAGGCTGGG + Intergenic
1055743716 9:79418828-79418850 GAAGAGTGGTCACAGAGGCTGGG - Intergenic
1055809204 9:80132199-80132221 GAGGGAAAGTTCTAGAGGCTGGG - Intergenic
1061809325 9:133153333-133153355 GAGGCGCAGTTACAAAGGCAGGG - Exonic
1203372489 Un_KI270442v1:321603-321625 GAGGGGGAGCAACAGAGCCTTGG - Intergenic
1186385188 X:9104124-9104146 GGGGGGCAATTCCAGAGGCTGGG - Intronic
1186893674 X:13985079-13985101 GAGAGGTTGTTACAGAGGTGAGG - Intergenic
1188373318 X:29395721-29395743 GACGAGTAGTTACTGAGTCTGGG - Intronic
1188373322 X:29395791-29395813 GACGAGTAGTTACTGAGTCTGGG - Intronic
1189465920 X:41277307-41277329 CAGGGATGGTTACAGATGCTGGG - Intergenic
1192524202 X:71827922-71827944 CTGGAGTAGGTACAGAGGCTAGG + Intergenic
1193437267 X:81490904-81490926 GAATGGTGGTTACAGAGGCTAGG + Intergenic
1199247305 X:145621031-145621053 GAGAGGAAGTGACAGAAGCTTGG + Intergenic
1200149529 X:153944470-153944492 GAGGGCTGGTTCCCGAGGCTGGG - Intronic