ID: 1021106699

View in Genome Browser
Species Human (GRCh38)
Location 7:16646115-16646137
Sequence CGGGGGCGGTACGGGAGGCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 409
Summary {0: 1, 1: 0, 2: 0, 3: 51, 4: 357}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021106677_1021106699 19 Left 1021106677 7:16646073-16646095 CCCCCGGGAGTGGCGCAGTCTGG 0: 1
1: 0
2: 0
3: 3
4: 78
Right 1021106699 7:16646115-16646137 CGGGGGCGGTACGGGAGGCGGGG 0: 1
1: 0
2: 0
3: 51
4: 357
1021106674_1021106699 28 Left 1021106674 7:16646064-16646086 CCCACCATTCCCCCGGGAGTGGC 0: 1
1: 0
2: 0
3: 7
4: 102
Right 1021106699 7:16646115-16646137 CGGGGGCGGTACGGGAGGCGGGG 0: 1
1: 0
2: 0
3: 51
4: 357
1021106672_1021106699 29 Left 1021106672 7:16646063-16646085 CCCCACCATTCCCCCGGGAGTGG 0: 1
1: 0
2: 0
3: 9
4: 132
Right 1021106699 7:16646115-16646137 CGGGGGCGGTACGGGAGGCGGGG 0: 1
1: 0
2: 0
3: 51
4: 357
1021106682_1021106699 16 Left 1021106682 7:16646076-16646098 CCGGGAGTGGCGCAGTCTGGGCG 0: 1
1: 0
2: 1
3: 10
4: 116
Right 1021106699 7:16646115-16646137 CGGGGGCGGTACGGGAGGCGGGG 0: 1
1: 0
2: 0
3: 51
4: 357
1021106676_1021106699 24 Left 1021106676 7:16646068-16646090 CCATTCCCCCGGGAGTGGCGCAG 0: 1
1: 0
2: 0
3: 15
4: 105
Right 1021106699 7:16646115-16646137 CGGGGGCGGTACGGGAGGCGGGG 0: 1
1: 0
2: 0
3: 51
4: 357
1021106675_1021106699 27 Left 1021106675 7:16646065-16646087 CCACCATTCCCCCGGGAGTGGCG 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1021106699 7:16646115-16646137 CGGGGGCGGTACGGGAGGCGGGG 0: 1
1: 0
2: 0
3: 51
4: 357
1021106681_1021106699 17 Left 1021106681 7:16646075-16646097 CCCGGGAGTGGCGCAGTCTGGGC 0: 1
1: 0
2: 2
3: 27
4: 248
Right 1021106699 7:16646115-16646137 CGGGGGCGGTACGGGAGGCGGGG 0: 1
1: 0
2: 0
3: 51
4: 357
1021106671_1021106699 30 Left 1021106671 7:16646062-16646084 CCCCCACCATTCCCCCGGGAGTG 0: 1
1: 0
2: 4
3: 18
4: 142
Right 1021106699 7:16646115-16646137 CGGGGGCGGTACGGGAGGCGGGG 0: 1
1: 0
2: 0
3: 51
4: 357
1021106679_1021106699 18 Left 1021106679 7:16646074-16646096 CCCCGGGAGTGGCGCAGTCTGGG 0: 1
1: 0
2: 0
3: 6
4: 119
Right 1021106699 7:16646115-16646137 CGGGGGCGGTACGGGAGGCGGGG 0: 1
1: 0
2: 0
3: 51
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021106699 Original CRISPR CGGGGGCGGTACGGGAGGCG GGG Exonic
900182163 1:1315828-1315850 CGGGGGCAGGGAGGGAGGCGGGG + Intronic
900671673 1:3858191-3858213 CGGGGTCGGTGCGGGTGGGGTGG + Intronic
901476792 1:9495365-9495387 CTGGGGCGCTACTTGAGGCGGGG - Intergenic
901673078 1:10867226-10867248 CGGGGGCCGTGAGGGAGGCGCGG + Intergenic
902760240 1:18576113-18576135 CGGGGGTGGGGGGGGAGGCGCGG - Intergenic
903233864 1:21937337-21937359 CGGGGGCGGGGCGGGCGGGGAGG - Intergenic
903573415 1:24322583-24322605 CGGCGGCGGCCCGGGCGGCGCGG + Intronic
904199769 1:28812209-28812231 CTGGGCCGGTGCGGGCGGCGAGG + Exonic
904215402 1:28914783-28914805 CGGCGGCGGCGCGGGAGCCGGGG + Intronic
904733297 1:32611494-32611516 CGGGGGCGGTGGGGGAAGGGGGG - Intronic
904753174 1:32753904-32753926 CGGGGGCGGGCCCGGAGGAGGGG - Intronic
904773434 1:32893500-32893522 TGGGGGCGGGAGGGGAGGCGGGG - Intronic
905132194 1:35769652-35769674 CGGCGGCGGGACGGGATGCCCGG + Intronic
905173988 1:36125093-36125115 CGAGGGCGGCCCGGGCGGCGAGG + Exonic
905414213 1:37793771-37793793 CGGGGGCGGGGGCGGAGGCGGGG - Intergenic
905655591 1:39684311-39684333 CCGGGGTGGGAGGGGAGGCGAGG - Intronic
907364269 1:53946287-53946309 CGGGGCCGGACCTGGAGGCGGGG - Exonic
909487633 1:76191365-76191387 TTGGGGAGGTATGGGAGGCGAGG + Intronic
910966269 1:92811041-92811063 CGGGCGCGGTCAGGAAGGCGCGG - Intergenic
912062304 1:105687571-105687593 CAGGTGCAGTAGGGGAGGCGTGG - Intergenic
912455133 1:109792101-109792123 CCAGGGAGGTACAGGAGGCGAGG - Intergenic
912471586 1:109910671-109910693 CGGGTGGGGGAGGGGAGGCGGGG + Exonic
915214062 1:154328611-154328633 CGGGGGTGGGAGGGGAGGCGGGG + Intronic
915531004 1:156502018-156502040 GGGAGGCGGGAGGGGAGGCGAGG - Intergenic
915564364 1:156705652-156705674 GGGGGGCGGAGCGGGAGGCGGGG - Intronic
916100567 1:161390146-161390168 GGGGGGCGGGACGAGAGGAGGGG + Intergenic
917944569 1:179955221-179955243 CGGTGGCGGCAAGAGAGGCGGGG + Intronic
920528614 1:206685687-206685709 CGGAAGCGGTCAGGGAGGCGAGG - Intronic
921075737 1:211698973-211698995 CGGGCGGGGGACGGGGGGCGGGG - Intergenic
922440716 1:225653214-225653236 AGGGGGCGGTGCGGGGGGAGGGG + Intergenic
922804507 1:228378456-228378478 AGGGGGCGGGACGGGAGGAGGGG - Intronic
923496579 1:234530983-234531005 CTGGGGCGGTGCGGGGGGTGGGG - Intergenic
1065024257 10:21526186-21526208 CCGGCGCGGTAGGGGAGGCCCGG - Intergenic
1073098941 10:100997197-100997219 CGGGGCCGGAACTGGAGCCGAGG + Intronic
1074532439 10:114306328-114306350 CGGGGGCAGGAGGGGACGCGGGG + Intronic
1074532447 10:114306346-114306368 CGGGGGCAGGAGGGGATGCGGGG + Intronic
1076495071 10:130891644-130891666 GGGGGGCGGTAGGGGCGGGGGGG - Intergenic
1076659720 10:132047671-132047693 GGGGGGCGGGACGGGAGGGTGGG - Intergenic
1076893003 10:133293957-133293979 CGGGGCCGGCCTGGGAGGCGTGG + Intronic
1077008521 11:369988-370010 CGGGGGCGGCGCGGGGGGCGCGG + Intronic
1077008534 11:370015-370037 CGCGGGCGGCGCGGGGGGCGCGG + Intronic
1077008542 11:370033-370055 CGCGGGCGGCGCGGGCGGCGGGG + Intronic
1077048126 11:555145-555167 CGGGGCGGGGACGGGAGGGGAGG + Intronic
1077048129 11:555150-555172 CGGGGACGGGAGGGGAGGGGAGG + Intronic
1077253633 11:1571467-1571489 CGGAGTCGGTCCGGGAGGTGTGG - Intronic
1077495792 11:2885965-2885987 CGGGGGCGGGGCGGGGCGCGCGG + Intergenic
1078023472 11:7673568-7673590 GGGGGCCGGAGCGGGAGGCGTGG - Intronic
1078266266 11:9758232-9758254 CGTGGGCGGGACGGGCGGCCTGG + Intergenic
1078679550 11:13463042-13463064 CGGGGGCGGCGCGGGAGGCTGGG - Intronic
1079076657 11:17388930-17388952 CGGGGGCGCTCCGGGAGGGGTGG - Intronic
1081863455 11:46347307-46347329 CTGGGGCGGTCCGAGGGGCGGGG - Intronic
1083207461 11:61161292-61161314 CGGGGGCGCTCCGGGAGCCACGG + Intronic
1083289231 11:61680544-61680566 CGGGCGCGGTGCGAGCGGCGCGG + Intronic
1083303271 11:61749835-61749857 CGGGGGCGGTGAGGGAGCTGCGG + Intergenic
1083329650 11:61891597-61891619 CGGGGGCGGGGGGGCAGGCGAGG - Intronic
1083674165 11:64316240-64316262 AGGGGGCTGCACGGGATGCGTGG + Exonic
1083883141 11:65558105-65558127 CGGGGGCCCGGCGGGAGGCGCGG + Exonic
1084195899 11:67523481-67523503 CGGGGGCGGGTGGGCAGGCGGGG + Intergenic
1084295979 11:68213601-68213623 CGGCGGCGGTGCGGGCGGCAGGG - Intronic
1084310220 11:68312501-68312523 CGCGGCCGGTGCGGGGGGCGCGG + Intergenic
1084973001 11:72781608-72781630 CGGGCGCGGGGCGGGTGGCGGGG + Intronic
1085522009 11:77144512-77144534 CAGGGGCAGTTCGGGAGGCTGGG + Intronic
1089169446 11:116501904-116501926 CAGGGGAGGGACGGGAGGCTGGG + Intergenic
1089227563 11:116938432-116938454 AGGGGACGGGACGGGAGGGGAGG + Intronic
1091226072 11:133957017-133957039 CGGGGGCGGTTCCGGAGGCCCGG - Intergenic
1091283433 11:134395209-134395231 CGGGGGCGGGTGGGGAAGCGGGG + Intronic
1092125921 12:6075084-6075106 AGGGGGCGCCAGGGGAGGCGTGG + Intronic
1092230305 12:6772452-6772474 GGGGGGCGGGCCGGGAGGAGGGG + Intergenic
1096007326 12:48183818-48183840 CGGGCGCGATCCGGGAGGCGAGG + Exonic
1096417276 12:51425051-51425073 CCGGGGAGGAGCGGGAGGCGCGG - Intronic
1096627341 12:52903875-52903897 CGGGGGCGGTGTGGGTGGGGTGG - Intronic
1097232870 12:57522903-57522925 CCGGGGCCGTACCGGAGGCTCGG + Exonic
1097267803 12:57755773-57755795 CGGGGGCGGCAGCGGCGGCGCGG - Exonic
1100553760 12:95672217-95672239 GGGGGGAGGGAGGGGAGGCGGGG + Intronic
1100611401 12:96194356-96194378 CCGGGGCGGCGGGGGAGGCGCGG + Intergenic
1103074269 12:117969310-117969332 CGGGGGCGGCGGGGGAGGCCGGG + Intergenic
1104376193 12:128267110-128267132 CGGGGGCGGGGCCGGGGGCGGGG + Intergenic
1105459080 13:20567059-20567081 AGGGGGTGGTGCGGGAGGCCTGG - Intronic
1105472509 13:20705309-20705331 CGGGGGCGGTGGGGGTGGGGGGG + Intronic
1106187888 13:27424931-27424953 CGGGGGAGGTGAGGGGGGCGAGG + Exonic
1108350343 13:49585642-49585664 CCGGGGCGGTGCGGGATGCTCGG - Intergenic
1112507857 13:99985577-99985599 CGGCGGCGGGGCGGGCGGCGGGG + Exonic
1114450645 14:22822781-22822803 CGGGGGCGGGAGGCGGGGCGAGG + Intronic
1114620650 14:24094339-24094361 CCGGGGAGGTATGGAAGGCGGGG - Exonic
1115851228 14:37591934-37591956 CGGGGGCGGGAGCGGAAGCGGGG - Exonic
1116886989 14:50231480-50231502 TGCGGGCGCTGCGGGAGGCGAGG - Exonic
1116945298 14:50830747-50830769 AGGGGCCGGTCCCGGAGGCGCGG - Intronic
1116958056 14:50944133-50944155 CGGGGGCGGGACGGCGGGCCGGG - Intronic
1117803108 14:59464981-59465003 CCGGGGCAGCGCGGGAGGCGGGG - Exonic
1118350939 14:64972161-64972183 CGGGGACGCTGCGGGCGGCGAGG + Intronic
1122108773 14:99480826-99480848 CGGCGGCCGGACGGGAGGGGCGG + Exonic
1122658508 14:103279085-103279107 CTGGGGCGGGTCGGGAGGGGAGG - Intergenic
1122904511 14:104795619-104795641 CGGCGGCGGCACGCGAGGCCCGG - Intronic
1123174176 14:106401486-106401508 AGTGGGCGGTCCGGGAGGCGCGG - Intergenic
1123182384 14:106482419-106482441 AGTGGGCGGTCCGGGAGGCGCGG - Intergenic
1202944519 14_KI270726v1_random:14311-14333 AGTGGGCGGTCCGGGAGACGCGG + Intergenic
1124848009 15:33310695-33310717 CGGGGGCGGTGCGGGGGCCCTGG - Intergenic
1124971136 15:34490520-34490542 CGGTGGCGGTGGAGGAGGCGGGG - Intergenic
1125200978 15:37100566-37100588 CTGGGGGGGTGGGGGAGGCGGGG + Intronic
1125201842 15:37107073-37107095 CGGGGGAGGTGGGGGTGGCGGGG + Intergenic
1125575835 15:40755018-40755040 CGGGGGGTGTACTGGAGGGGCGG - Exonic
1126109505 15:45167301-45167323 CGGGGACGGCGCCGGAGGCGCGG + Exonic
1126113231 15:45187576-45187598 CGGGGGCGACAGGGGTGGCGAGG + Intronic
1126113264 15:45187679-45187701 CGGGGGCGGCGCGGGGGGCGCGG + Intronic
1126172316 15:45704970-45704992 CGGGGGCGGTGCTGGGTGCGAGG - Intergenic
1126172325 15:45704995-45705017 CGGGGGCGGTGCTGGGTGCGAGG - Intergenic
1127144149 15:56007371-56007393 CGGCGGCGGCGGGGGAGGCGGGG + Intergenic
1127537608 15:59904531-59904553 TGGGGGCGGGGCGGGGGGCGGGG + Intergenic
1127922477 15:63504432-63504454 CGGGGGCGGACCCGGGGGCGGGG + Intergenic
1128067798 15:64775414-64775436 CGGGTGCGGAGCGGGTGGCGGGG + Exonic
1128139221 15:65286886-65286908 CGGCGGCGCGGCGGGAGGCGGGG - Intronic
1131144434 15:90002030-90002052 CGGCGGCGGCGCGGGAGGCCCGG + Intronic
1132604571 16:788408-788430 CGGGGGCGGGCCGGGGGGGGGGG - Intergenic
1132683442 16:1153014-1153036 CGGGGGCGGGGCGGGCGGGGGGG - Intergenic
1132727622 16:1345679-1345701 CTGGGGAGGTGGGGGAGGCGGGG - Intronic
1132753224 16:1468654-1468676 CTCGGGCCGGACGGGAGGCGAGG + Intronic
1133156567 16:3880470-3880492 CGGCGGCGGAACGGGGGGTGGGG - Exonic
1133272374 16:4616458-4616480 CGGGGGCGGAGCCGGGGGCGGGG + Intergenic
1133801672 16:9090577-9090599 AGGGGCCGGTACGTGACGCGGGG + Intergenic
1133956418 16:10447612-10447634 CGGGGGAGGTGGGGGAGGCAGGG - Intronic
1136913022 16:34159630-34159652 CGGAGGCGGTGGGGGAGCCGCGG + Intergenic
1137707906 16:50548273-50548295 CGGGGGCGGGGCCGGAGGCGGGG - Intergenic
1138507710 16:57486423-57486445 CGGGGACGGCGAGGGAGGCGCGG + Exonic
1138533471 16:57647350-57647372 TGGGGGCCGTACGGGAAGAGGGG + Intronic
1140734787 16:77888682-77888704 CGCTGGCGGTACGGGAGTAGAGG - Intronic
1141772746 16:86101040-86101062 CGTGGGGGGTTCGGGAAGCGGGG + Intergenic
1142136245 16:88453217-88453239 CGGGGGCGGGGCGGGAGGTGCGG + Intergenic
1142167171 16:88598283-88598305 CGGGTGAGGTCCGAGAGGCGGGG - Exonic
1142184186 16:88686562-88686584 CGGGGGCGGAACTGAGGGCGAGG + Intergenic
1142206476 16:88785334-88785356 CGGAGGCGGGACGGGCCGCGCGG - Intergenic
1142221481 16:88857002-88857024 CCGCGGAGGGACGGGAGGCGGGG + Intronic
1142683245 17:1562361-1562383 GGCGGGCGGCACGTGAGGCGGGG - Intronic
1143297671 17:5883473-5883495 CGGGGAGGGGACGGGAGGGGAGG - Intronic
1143448912 17:7024104-7024126 CCGGGGCCGTGCGGGAGTCGGGG + Exonic
1143579569 17:7817729-7817751 TGGGGGCGGTACGGGAGCATGGG + Intronic
1145190577 17:20840697-20840719 CGGTGGCGGTGCAGGAGGCCGGG + Intronic
1146053302 17:29568650-29568672 CGCGGGCGGCGCGGGCGGCGCGG + Exonic
1146058663 17:29593444-29593466 CCGGCGCGGTGCGGGCGGCGCGG - Intronic
1146276178 17:31517197-31517219 GGGGGGCGGTGGGGGGGGCGGGG + Intronic
1146281880 17:31549981-31550003 CGGGGGCGGGACCGGGGGCGGGG + Intergenic
1147189251 17:38729499-38729521 AGGGGGCGGGACGGGAGCAGGGG - Exonic
1147250848 17:39151692-39151714 AGGGGGCGGGGCGGGGGGCGCGG + Intronic
1147994637 17:44354063-44354085 CGGCGGCGGCGCGGCAGGCGGGG + Exonic
1148346687 17:46908176-46908198 GGGGGGCGGTGGGGGAGGAGGGG - Intergenic
1148854367 17:50570686-50570708 CTGGGGCGGGAGAGGAGGCGAGG - Intronic
1149567836 17:57652299-57652321 AGGGGGTGGACCGGGAGGCGCGG + Intronic
1150373658 17:64662358-64662380 CGGGGAGGAGACGGGAGGCGGGG + Intergenic
1150643455 17:66964584-66964606 CGGCGGCGGCGGGGGAGGCGCGG + Intergenic
1151660657 17:75516442-75516464 CTGGGGCGGTGCAGGGGGCGGGG + Intronic
1151990568 17:77571406-77571428 GGGAGGCGGGAGGGGAGGCGAGG + Intergenic
1152242092 17:79166139-79166161 CGGGGGGGGAACAGGAGGGGTGG - Intronic
1152544067 17:80992027-80992049 CGGGGCCGGGGCGGGCGGCGGGG + Intronic
1152756892 17:82090733-82090755 TGGGGGCAGGACGGGAGGGGAGG - Intronic
1153855123 18:9137286-9137308 CGGGGGCGCTGCGCGGGGCGGGG + Intronic
1154210837 18:12377342-12377364 TGGGGGCGGGACCGGAGGCGGGG + Intergenic
1157158651 18:45291820-45291842 CGGGGGCGGTTGGGGGGGTGGGG + Intronic
1157239686 18:45997653-45997675 CGGGGGGGGGAGGGGAGGAGGGG - Intronic
1158435946 18:57435678-57435700 CGGGGGCGGCGGGGGCGGCGGGG - Exonic
1160500781 18:79400357-79400379 CGGGGCCGGGGCGGGAGCCGGGG - Intronic
1160776805 19:860432-860454 CGGGGGCGGGGGGGGAGGGGGGG - Intronic
1160790456 19:920575-920597 CGGGGGCGGCGGGGGCGGCGCGG - Exonic
1160826192 19:1081651-1081673 CGGGGGCGCTGCGGGCCGCGTGG - Exonic
1160996738 19:1885441-1885463 CGGTGGCGGTGCAGGAGGCCGGG - Intronic
1161073438 19:2273692-2273714 CTGGGGCGGAAGGGGACGCGAGG - Intronic
1161408330 19:4102676-4102698 CGAGGATGGGACGGGAGGCGGGG - Intronic
1161471125 19:4457321-4457343 AGGGGGCGGGGCGGGAGGGGAGG - Intronic
1161583929 19:5094977-5094999 CGGGGGCGGCGCCGGGGGCGGGG + Intronic
1161702941 19:5805007-5805029 CGGGGGCGGGGCCGGGGGCGGGG - Intergenic
1162019624 19:7862707-7862729 CGGGGCCGGATCAGGAGGCGGGG - Intronic
1162019657 19:7862784-7862806 CGGGGGCGGGTCAGGAGGCGTGG - Intronic
1162028679 19:7908227-7908249 CGGGAGGGGCACGGGAGGTGAGG + Intronic
1162427017 19:10602844-10602866 CGGGCGGGGGAGGGGAGGCGCGG + Intronic
1163424952 19:17236093-17236115 TGGGGGCGGGAGGGGAGGCGGGG + Intronic
1163573563 19:18097759-18097781 CGGGGGCGGGCCTGGCGGCGCGG + Intronic
1163708624 19:18832374-18832396 CGGTGGCGGCGCGGGAGGCCCGG + Exonic
1165493918 19:36141047-36141069 CGGCGGCGGCGGGGGAGGCGGGG + Exonic
1166014641 19:39970978-39971000 CGAGGGCGGGACGGGAGCTGTGG - Intergenic
1166136083 19:40778137-40778159 AGGGGGCGGGACAAGAGGCGCGG - Intronic
1166361327 19:42254040-42254062 CGGGGGCGGCGGGGGAGGGGAGG + Intronic
1166373159 19:42313536-42313558 CGGGGGACGCAAGGGAGGCGAGG + Intronic
1166524172 19:43500896-43500918 GGGGGGGGGTACGGGGGGCGGGG - Intronic
1166547011 19:43639844-43639866 GGGGGGCGGGGCGGGCGGCGCGG - Intergenic
1166882946 19:45940222-45940244 CGGGGCCGGGGCGGGCGGCGGGG - Exonic
1166995330 19:46717190-46717212 CGGGGGCGGAAGGGGAGGGTGGG + Intergenic
1167018272 19:46856163-46856185 CGAGGCAGGAACGGGAGGCGGGG - Intergenic
1167112741 19:47471700-47471722 TGGGGGCGGTTCGGGAAGCCTGG - Intronic
1167112856 19:47472041-47472063 GGAAGGCGGTGCGGGAGGCGGGG + Exonic
1167578530 19:50329088-50329110 GGGGGGCGGGGCGGGAGGGGCGG + Exonic
1167652178 19:50738064-50738086 CCGGGGCGGTGCGGCAGGCCAGG - Intergenic
1168153960 19:54463094-54463116 CGAGGTCGGTGCGCGAGGCGCGG + Exonic
1168315156 19:55481880-55481902 CGGAGGCGGTACCCGGGGCGGGG - Exonic
1168315194 19:55481990-55482012 GGGCGGCGGGGCGGGAGGCGCGG - Exonic
1168343756 19:55640894-55640916 CGGGGAGGGGACCGGAGGCGTGG - Intronic
926089887 2:10043218-10043240 CGGGGGCGGAGGGGGCGGCGGGG - Intronic
926089897 2:10043236-10043258 CGGGGGCGGAGGGGGCGGCGGGG - Intronic
926497192 2:13605033-13605055 AGGGGACGGTAGGGGAAGCGAGG - Intergenic
927713867 2:25341046-25341068 CGGGGCCGGGAGGGGCGGCGGGG - Intronic
928096911 2:28410405-28410427 CGGGGGAGGTGGGGGAGGCAGGG - Intronic
929285951 2:40135465-40135487 TGGGGGCGGCAGGGGAGGGGTGG + Intronic
929983017 2:46698990-46699012 CGGGGGCGGCCCGGGAGTCGGGG - Exonic
931695021 2:64865125-64865147 TGGGGGAGGTGCGGGAGGAGAGG - Intergenic
932331330 2:70900093-70900115 CGGTGGGGGTGCTGGAGGCGGGG - Intergenic
932496690 2:72149068-72149090 CCGGGGCGGGGCGGGAGGCCGGG - Intergenic
932608022 2:73177275-73177297 CGGGGGCGGTAAAGGATGGGTGG - Intergenic
932780228 2:74554692-74554714 GGGAGGCGGGGCGGGAGGCGGGG - Exonic
932881510 2:75506473-75506495 TAGGGGTGGTACTGGAGGCGTGG + Intronic
934966819 2:98730994-98731016 CGGGGGCGGGAGGGGGCGCGGGG - Intronic
935592567 2:104855630-104855652 CGGGGGCGGCGCAGGGGGCGGGG + Exonic
936388983 2:112055138-112055160 TGGGGGCGGGGTGGGAGGCGTGG - Intergenic
937991383 2:127664274-127664296 CAGGGGCGGGGCGGGTGGCGGGG - Intronic
938414432 2:131092994-131093016 CAGGTGCGGTCCGGGCGGCGCGG - Intronic
938536596 2:132253645-132253667 CGGAGTCGGCAGGGGAGGCGAGG + Intronic
940775023 2:157876104-157876126 CGGGGGAGGGCGGGGAGGCGGGG + Intergenic
945225913 2:207530586-207530608 CGGGGGCGAGGCGGGCGGCGGGG - Intronic
946339975 2:219060583-219060605 CGGGGGCGCCATGGGCGGCGTGG + Intergenic
946387959 2:219397203-219397225 CGGGGGTGGGAGGGGAGGGGAGG - Intronic
946421949 2:219570358-219570380 CGGCGGCGGTCCGGGAGCAGCGG + Exonic
947774522 2:232697262-232697284 CGGGGGCGGAGCAGGGGGCGTGG + Intergenic
947792466 2:232876115-232876137 GGGCGGCGGTACGGGCGGGGCGG + Exonic
948172626 2:235917240-235917262 CAGGGGAGGTGGGGGAGGCGGGG + Intronic
948502540 2:238406050-238406072 CGGTGGTGGGACGGGAGGCCTGG - Intergenic
1168855026 20:1002228-1002250 CGGCGGCGGCACGGCGGGCGCGG + Exonic
1169262461 20:4148791-4148813 CGGGGTGGGTAGGGGACGCGAGG + Exonic
1169278481 20:4248852-4248874 CGGGGGCAGCGCGGGCGGCGCGG - Exonic
1173454141 20:43189923-43189945 CGGGGGCGGGACGCGGGGGGCGG + Exonic
1173579538 20:44137397-44137419 CTGGGGAGGGGCGGGAGGCGGGG - Intronic
1173605203 20:44326771-44326793 CGGGGGCGGGATGGGGGGAGGGG + Intergenic
1173649101 20:44651739-44651761 GGCGGGCGGGGCGGGAGGCGGGG - Exonic
1173734310 20:45348490-45348512 CGGGCGGGGTGCGGGCGGCGGGG - Intergenic
1175749210 20:61483669-61483691 CGGGGGCGGGGCGGGGGGGGCGG - Intronic
1175847062 20:62064911-62064933 GGGGGGCGGCACGGCGGGCGCGG + Exonic
1175957921 20:62621079-62621101 AGGGGGAGGCACGGGAGGGGTGG - Intergenic
1175957941 20:62621123-62621145 AGGGGGAGGCACGGGAGGGGTGG - Intergenic
1175957952 20:62621146-62621168 TGGGGGAGGCACGGGAGGGGTGG - Intergenic
1175957962 20:62621166-62621188 AGGGGGAGGCACGGGAGGGGTGG - Intergenic
1175957973 20:62621189-62621211 AGGGGGAGGCACGGGAGGGGTGG - Intergenic
1175957984 20:62621212-62621234 AGGGGGAGGCACGGGAGGGGTGG - Intergenic
1176131766 20:63499304-63499326 CGGGGGCGGGGCGGGGGGCAGGG + Exonic
1176309996 21:5144501-5144523 CAGAGGAGGTGCGGGAGGCGCGG + Intronic
1176376912 21:6091408-6091430 CGGTGGCGCGGCGGGAGGCGTGG + Intergenic
1176380704 21:6111033-6111055 CGGGGGCGGGGCAGGGGGCGGGG + Intergenic
1178466191 21:32850197-32850219 GGGGGGCGGGAGGGGAGGAGGGG + Intergenic
1178544282 21:33480042-33480064 CGGGGGCGGGGCGGGACGCGAGG + Intergenic
1178610203 21:34073402-34073424 CGGGGGCGGTGCGGCGGGTGCGG + Intronic
1179168925 21:38957798-38957820 GGGGGGCGGTGCGGGTGGAGGGG + Intergenic
1179605686 21:42513939-42513961 CGGGGCCGGACCGGGAGGCGGGG + Exonic
1179621273 21:42617764-42617786 CGGGGGAGGCAGGGGAGGCAGGG - Intergenic
1179742768 21:43427207-43427229 CGGGGGCGGGGCAGGGGGCGGGG - Intergenic
1179746563 21:43446836-43446858 CGGTGGCGCGGCGGGAGGCGTGG - Intergenic
1179847060 21:44117531-44117553 CAGAGGAGGTGCGGGAGGCGCGG - Intronic
1180042353 21:45287248-45287270 TGGGGGCGGGGCGGGAGCCGGGG - Intronic
1180047575 21:45316835-45316857 CGGGGGAGGTGGGGGAGGCCGGG + Intergenic
1180095960 21:45555380-45555402 CGGGGACAGTATGGGAGGCAGGG + Intergenic
1180831892 22:18910853-18910875 CGGGGGCGGCGGGGGAGGTGAGG - Intronic
1181121706 22:20671293-20671315 CGGTGGCGGTGCAGGAGGCCGGG - Intergenic
1181334674 22:22118333-22118355 CGGTGGCGGTGCAGGAGGCCGGG - Intergenic
1181876750 22:25945898-25945920 AGGGGAGGGTAGGGGAGGCGAGG - Intronic
1182122857 22:27798416-27798438 CGGGGGCAGTCTGGGAGGCCTGG - Exonic
1183401747 22:37608995-37609017 CGGGGGCGGGGCGTGAGGAGGGG - Intronic
1183606989 22:38871862-38871884 CGGGGGCGTCGCGGGAGGGGAGG - Intronic
1183961477 22:41414059-41414081 CGGAGGCGCTGCGGCAGGCGAGG - Intergenic
1184343067 22:43896656-43896678 CGGGGGCGGTCGGGGGGGGGGGG - Intergenic
1185266219 22:49905686-49905708 CGCAGGCTGTACGGGAAGCGTGG - Intronic
1185313901 22:50170634-50170656 CGCGGGCGGGAGGGGACGCGCGG - Intergenic
1185313922 22:50170678-50170700 CGCGGGCGGGGCGGGGGGCGCGG - Intergenic
1185403050 22:50628192-50628214 CGGGGGCGGGGCCGGGGGCGGGG + Intergenic
1203281970 22_KI270734v1_random:136124-136146 CGGGGGCGGCGGGGGAGGTGAGG - Intergenic
950730095 3:14948589-14948611 CGGGGGCGGGGCCGGGGGCGGGG + Intronic
953406983 3:42664519-42664541 CGGGGGCGGCAGGTGGGGCGGGG - Exonic
954004218 3:47578866-47578888 CAGCGGCGGCGCGGGAGGCGGGG - Exonic
954733568 3:52685875-52685897 CGGGAGGGGTAAGGGAGGTGAGG - Intronic
959593404 3:108103260-108103282 CAGGGGCGGGAAGGGAGGCGGGG + Intergenic
961654317 3:128433019-128433041 CGGGGGCGGCACGCGAGCCCGGG - Intergenic
966886459 3:184380202-184380224 CGGGGGCGGTGCGGCGGGAGGGG - Exonic
966919385 3:184602056-184602078 CGCGGGCGGGGCGGGAGGGGAGG + Intronic
967640456 3:191856618-191856640 CTGGGGTGGTACAGGAGGAGGGG - Intergenic
967791276 3:193551726-193551748 CTGGGACGGGACGGGAGGCCTGG - Intronic
968514294 4:1009866-1009888 CGGGGCCGGGACGGGGGGCGGGG - Intergenic
968598082 4:1495663-1495685 CGGGGGCGGTGGAGGGGGCGAGG - Intergenic
968729108 4:2261495-2261517 CGCGAGCGGCCCGGGAGGCGCGG + Intronic
968908053 4:3463562-3463584 CGGGCGGGGGACGGGGGGCGCGG + Intronic
968952011 4:3700231-3700253 GGGGGGAGGTAGGGGAGGAGTGG + Intergenic
970202858 4:13627455-13627477 CGCGGGCGGGGCGGGCGGCGCGG - Exonic
972396618 4:38663983-38664005 CGGAGGCGGCGCGGGAGGCGGGG + Intergenic
973613795 4:52659669-52659691 CGGGGACGGTACGGTGCGCGGGG + Intergenic
974016852 4:56656031-56656053 CGGCGGCGGTGAGCGAGGCGTGG + Intronic
975986171 4:80202884-80202906 TGGGGGCGGAACGGGCGCCGGGG + Exonic
977809695 4:101346054-101346076 CGCGGGGGGCGCGGGAGGCGGGG - Intronic
978576607 4:110196431-110196453 AGGGGGTGGTGCTGGAGGCGGGG - Intronic
983537871 4:168877818-168877840 CGGCGGCGGGAAGGGGGGCGAGG - Intronic
985629855 5:1008750-1008772 CGGGGGCGCTGCGGGGGCCGCGG + Intergenic
985651909 5:1111491-1111513 CCCGGGCGGTTCGGGAGCCGGGG - Intronic
985659141 5:1147243-1147265 CGGGGGCGGGGGGGGTGGCGGGG - Intergenic
986858962 5:11904291-11904313 CGGCGGCGGCACAGGTGGCGCGG - Intergenic
988714236 5:33809340-33809362 TGGGGGCGGGATGGGAGGAGTGG - Intronic
990234519 5:53752428-53752450 TGGGAGCGCTACGGGAGACGGGG + Intergenic
990545127 5:56815263-56815285 CGGGGGCGGAGGCGGAGGCGTGG - Intergenic
990581839 5:57173594-57173616 GGGGGGAGGTGCGGGAGGAGGGG + Intergenic
991707131 5:69369286-69369308 CGCGGGCGTTGCGGGAGGCGAGG - Intronic
992320919 5:75612324-75612346 CGGGGGCGGGGCGGAGGGCGGGG - Intronic
992448832 5:76857476-76857498 TGGGGGCAGGACGGGAGGTGGGG - Intronic
992663610 5:78984903-78984925 CGGGGGCGGCGCGGGCGGCGGGG + Intronic
993457370 5:88141738-88141760 CGGGGGCGGGGGCGGAGGCGGGG - Intergenic
993921066 5:93803438-93803460 GGGGGGCGGTGAGGGAGGAGAGG - Intronic
995224723 5:109689846-109689868 CGGGGGCGGTGCCGGTGCCGCGG + Exonic
996443033 5:123512693-123512715 CGGGGGCGGCGCCGCAGGCGCGG + Intronic
997980715 5:138465962-138465984 CGGGGGCGGTGGAGGCGGCGGGG + Exonic
998200476 5:140114274-140114296 CGGGGGCGGTGGTGGCGGCGGGG + Exonic
998236435 5:140402159-140402181 CGGCAGCGGTACGGGCGGAGGGG + Exonic
998849351 5:146338874-146338896 CAGGGGCGGCCCGGGAGGTGAGG - Intronic
1001382110 5:171311805-171311827 CTGGGGCGGGACGGGGCGCGGGG - Exonic
1001506563 5:172284244-172284266 CGGGGGGAGGACTGGAGGCGAGG + Intergenic
1002138329 5:177122441-177122463 TGGGGGTGGTACCAGAGGCGGGG - Intergenic
1002800358 6:516287-516309 CTGGGGCGGCACTGGAGGAGAGG + Intronic
1003290956 6:4777145-4777167 CGTGGGCGGTACGGGGGGTGGGG + Intronic
1003421096 6:5959203-5959225 CGGGGGAGGGGGGGGAGGCGTGG + Intergenic
1003645372 6:7910129-7910151 CCGGGGCGGTGCGGGAGGAGGGG - Intronic
1003873752 6:10420006-10420028 CGTGGGCGGGTGGGGAGGCGGGG - Intergenic
1003911451 6:10747630-10747652 CGGGGGCGGGGAGTGAGGCGGGG - Intergenic
1004043990 6:12009259-12009281 CGGGGGCGGGCAGGGTGGCGCGG + Intronic
1005724501 6:28635483-28635505 AAGGGGCGGTATGGAAGGCGGGG - Intergenic
1006177330 6:32130226-32130248 GGGGCGCGGTGCGGGAGGCGGGG + Exonic
1006717609 6:36130471-36130493 CGGGGGAGGAGCGGGCGGCGCGG + Exonic
1007383308 6:41504171-41504193 CGGGGGCAGAACGCGAGGCTGGG + Intergenic
1008556386 6:52676698-52676720 CGCAGGCTGTACAGGAGGCGTGG + Intronic
1010211160 6:73363649-73363671 CGGTGGAGGTCCGGGAGGCCGGG + Exonic
1011410256 6:87059782-87059804 CGGGGGAGGTGGGGGAGGCAGGG + Intergenic
1012400005 6:98835086-98835108 CGGGGGCGGTGGCGGCGGCGGGG + Exonic
1012950981 6:105517599-105517621 TGGGGGCTGTGAGGGAGGCGGGG + Intergenic
1018856468 6:167678762-167678784 CGGGGGCGGGGCGGGAGGCCGGG - Intergenic
1019111814 6:169723690-169723712 CGGGGGTGGTCGGCGAGGCGGGG - Intronic
1019409867 7:901746-901768 CGGGGGAAGGAGGGGAGGCGGGG - Intronic
1019474295 7:1236613-1236635 CGCGGGCGGCACGGCGGGCGCGG - Exonic
1019479357 7:1259559-1259581 CGGGGGCTGTTAGGGAGGGGCGG + Intergenic
1020274366 7:6615684-6615706 CGGGGGCGGGGCGGGCGCCGCGG - Exonic
1021106691 7:16646097-16646119 CGGGGGCGGTCTAGGAGACGGGG + Intergenic
1021106699 7:16646115-16646137 CGGGGGCGGTACGGGAGGCGGGG + Exonic
1021890184 7:25180001-25180023 CGGGGAGGGGAGGGGAGGCGCGG - Intronic
1023773773 7:43583675-43583697 CGATGGCGGTCCCGGAGGCGCGG + Intronic
1023944994 7:44796417-44796439 GGGCGGCAGTACGGGACGCGGGG - Intergenic
1026968332 7:74454012-74454034 CGAGGGCGGGGAGGGAGGCGCGG - Exonic
1028121429 7:87059734-87059756 CGGGGGCGGGACGCGGGGCGGGG + Intergenic
1029423582 7:100483864-100483886 TGGGGGCGGACCCGGAGGCGGGG + Intergenic
1029701362 7:102248736-102248758 CGGTGGCGGTCGCGGAGGCGGGG - Exonic
1031134911 7:117873622-117873644 CGGGCGCGGGACGCGGGGCGCGG - Intronic
1031833917 7:126659030-126659052 TGGGGGCGGGGCGGGGGGCGGGG - Intronic
1032119318 7:129144956-129144978 CGGGGGCGGTGGCGGCGGCGGGG + Exonic
1032819343 7:135510145-135510167 CGGGGGAGGGGCGGGAGGAGCGG + Intergenic
1033683781 7:143620918-143620940 GCGGGGCGGTCCCGGAGGCGGGG - Intergenic
1033700831 7:143836720-143836742 GCGGGGCGGTCCCGGAGGCGGGG + Intergenic
1034222777 7:149459496-149459518 CGGGGGCGGCGGGGGAGGCCGGG - Intronic
1034306502 7:150048482-150048504 CGGGGGCGGTGGGGGAGTCCCGG + Intergenic
1034344780 7:150379479-150379501 CGGAGGCAGCACGGGAGGAGCGG - Intronic
1034418774 7:150978351-150978373 CGGGAGGGGGCCGGGAGGCGGGG - Intergenic
1034426924 7:151018804-151018826 CGGCGGCGGGGCGGTAGGCGCGG + Exonic
1034800345 7:154052161-154052183 CGGGGGCGGTGGGGGAGTCCCGG - Intronic
1035167456 7:157000075-157000097 CGGGGGCGGAGCGGGGCGCGGGG + Intronic
1037535153 8:19817115-19817137 CGGGGGCGGGGGCGGAGGCGGGG - Intergenic
1037911654 8:22747359-22747381 CGGGTGCTGTACAGGAGGCTGGG - Intronic
1037917063 8:22779069-22779091 CGGGGGAGGTGGGGGAGGAGGGG + Intronic
1039996889 8:42541769-42541791 CCGGGGCGGGGCGGGCGGCGCGG - Intronic
1040423489 8:47261213-47261235 CAGCGGCGGTACGGAAAGCGAGG + Intronic
1042995497 8:74693604-74693626 CGGGGGCGGGGGGGGAGGGGTGG + Intronic
1044391091 8:91651994-91652016 AGGGGACGGGACGGGAGGGGAGG + Intergenic
1044732287 8:95238948-95238970 GGGGGGTGGTAGGGGAGGCAGGG - Intergenic
1045407357 8:101880087-101880109 GGGGGGCGGTGAGGGAGGCTGGG + Intronic
1045510770 8:102810627-102810649 CGGGGGTGGGAGGGGAGGCCGGG - Intergenic
1047732364 8:127737670-127737692 CGGGGGCGGTACTGGGGGTGGGG + Intronic
1049245916 8:141562433-141562455 CGGGGGCGGGAGGGAAGGCGTGG + Intergenic
1049408805 8:142463416-142463438 CGGGGGCCAGACGGGAGGCTGGG + Intronic
1049532249 8:143160357-143160379 CGGGGGCCGCGCGGGGGGCGGGG + Intronic
1049803599 8:144529127-144529149 CGGGGGCGGGAAGAGACGCGGGG - Exonic
1049828633 8:144685882-144685904 CGGGGGCGGAGCCGGAGGCGGGG - Intergenic
1054449920 9:65398226-65398248 CGGGGGAGGGAGGGGAGGCGGGG + Intergenic
1054449930 9:65398244-65398266 CGGGGGAGGGAGGGGAGGCGGGG + Intergenic
1054449940 9:65398262-65398284 CGGGGGAGGGAGGGGAGGCGGGG + Intergenic
1054449950 9:65398280-65398302 CGGGGGAGGGAGGGGAGGCGGGG + Intergenic
1054449960 9:65398298-65398320 CGGGGGAGGGAGGGGAGGCGGGG + Intergenic
1054449970 9:65398316-65398338 CGGGGGAGGGAGGGGAGGCGGGG + Intergenic
1054449980 9:65398334-65398356 CGGGGGAGGGAGGGGAGGCGGGG + Intergenic
1054449990 9:65398352-65398374 CGGGGGAGGGAGGGGAGGCGGGG + Intergenic
1054450000 9:65398370-65398392 CGGGGGAGGGAGGGGAGGCGGGG + Intergenic
1054450010 9:65398388-65398410 CGGGGGAGGGAGGGGAGGCGGGG + Intergenic
1054450020 9:65398406-65398428 CGGGGGAGGGAGGGGAGGCGGGG + Intergenic
1054450030 9:65398424-65398446 CGGGGGAGGGAGGGGAGGCGGGG + Intergenic
1055611774 9:78031576-78031598 CGGCGGCGGCTCGGGGGGCGAGG - Intergenic
1056643416 9:88389000-88389022 CGGGGGCGGGGCGGGGGGAGGGG + Intronic
1057259665 9:93576672-93576694 CGGGGGCGGCGGGGGCGGCGGGG - Exonic
1057596443 9:96418869-96418891 CGAGGGCGGGGCGGGCGGCGGGG - Intergenic
1059375209 9:113876102-113876124 CGGGGGCGGGCAGGGCGGCGGGG + Intergenic
1060445265 9:123681328-123681350 CGGGGGAGGGGAGGGAGGCGAGG + Intronic
1060550505 9:124482709-124482731 TGGGGGCGGGACTGGGGGCGGGG - Exonic
1061000429 9:127899451-127899473 CGGGGGCGGGGGCGGAGGCGGGG - Intronic
1061348205 9:130043227-130043249 CGGGGGAGGGGCGGGAGGGGAGG + Intergenic
1061446264 9:130640026-130640048 CGGTCGGGGTCCGGGAGGCGGGG + Intergenic
1062015174 9:134287743-134287765 CGGGGGCGGGAGGGAAGGTGGGG - Intergenic
1203773049 EBV:59131-59153 CGGGGGCGGGAGTGGAGGCTCGG - Intergenic
1189005131 X:36986452-36986474 CGGGGGCGGAGCGGGAGGAGTGG - Intergenic
1189043892 X:37571490-37571512 CGGGGGCGGAGCGGGAGGAGTGG + Intronic
1189197215 X:39162502-39162524 CTGGGGCGGGAAGGGAGGCTGGG + Intergenic
1190368159 X:49716999-49717021 CGGGGGCGGGGGGGGAGGGGGGG - Intergenic
1190984437 X:55488547-55488569 CGGGGGCCGGGCTGGAGGCGGGG + Exonic
1193148814 X:78104185-78104207 AAGGGGCGGTGCGGGAGGCGGGG + Exonic
1195000189 X:100636334-100636356 CGAGTTCGATACGGGAGGCGAGG - Intronic
1195923231 X:110002808-110002830 CCGGGGCTGGGCGGGAGGCGCGG + Intronic
1196633623 X:117973826-117973848 CGGGGGAGGGAGGGGAGGAGTGG - Intronic
1196854526 X:119970374-119970396 CGGGGGGGGGGCGGGGGGCGGGG + Intergenic
1200146898 X:153931034-153931056 CGGGGGCAGGACGGGTGGGGCGG - Intronic
1200323814 X:155216798-155216820 CGGGGCCGGGACGAGGGGCGAGG + Intronic