ID: 1021106725

View in Genome Browser
Species Human (GRCh38)
Location 7:16646300-16646322
Sequence CGGCGCCCCTTGCCTCACCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 150}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021106725_1021106735 26 Left 1021106725 7:16646300-16646322 CCCAGGTGAGGCAAGGGGCGCCG 0: 1
1: 0
2: 1
3: 11
4: 150
Right 1021106735 7:16646349-16646371 GCCCCGCCGGGGTTTCCATCGGG 0: 1
1: 0
2: 0
3: 5
4: 55
1021106725_1021106732 15 Left 1021106725 7:16646300-16646322 CCCAGGTGAGGCAAGGGGCGCCG 0: 1
1: 0
2: 1
3: 11
4: 150
Right 1021106732 7:16646338-16646360 TAGCGACTGCCGCCCCGCCGGGG 0: 1
1: 0
2: 0
3: 1
4: 40
1021106725_1021106730 13 Left 1021106725 7:16646300-16646322 CCCAGGTGAGGCAAGGGGCGCCG 0: 1
1: 0
2: 1
3: 11
4: 150
Right 1021106730 7:16646336-16646358 AGTAGCGACTGCCGCCCCGCCGG 0: 1
1: 0
2: 0
3: 3
4: 25
1021106725_1021106739 30 Left 1021106725 7:16646300-16646322 CCCAGGTGAGGCAAGGGGCGCCG 0: 1
1: 0
2: 1
3: 11
4: 150
Right 1021106739 7:16646353-16646375 CGCCGGGGTTTCCATCGGGCAGG 0: 1
1: 0
2: 1
3: 1
4: 42
1021106725_1021106734 25 Left 1021106725 7:16646300-16646322 CCCAGGTGAGGCAAGGGGCGCCG 0: 1
1: 0
2: 1
3: 11
4: 150
Right 1021106734 7:16646348-16646370 CGCCCCGCCGGGGTTTCCATCGG 0: 1
1: 0
2: 0
3: 3
4: 41
1021106725_1021106731 14 Left 1021106725 7:16646300-16646322 CCCAGGTGAGGCAAGGGGCGCCG 0: 1
1: 0
2: 1
3: 11
4: 150
Right 1021106731 7:16646337-16646359 GTAGCGACTGCCGCCCCGCCGGG 0: 1
1: 0
2: 0
3: 7
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021106725 Original CRISPR CGGCGCCCCTTGCCTCACCT GGG (reversed) Exonic
900013957 1:136582-136604 CTGAGCCCCTTGCCTCACACCGG - Intergenic
900013971 1:136631-136653 CTGAGCCCCTTGCCTCACACCGG - Intergenic
900013985 1:136680-136702 CTGAGCCCCTTGCCTCACACCGG - Intergenic
900014012 1:136777-136799 CCGAGCCCCTTGCCTCACACCGG - Intergenic
900014026 1:136826-136848 CCGAGCCCCTTGCCTCACACCGG - Intergenic
900014040 1:136875-136897 CCGAGCCCCTTGCCTCACACCGG - Intergenic
900014055 1:136924-136946 CCGAGCCCCTTGCCTCACACCGG - Intergenic
901059620 1:6465995-6466017 CGGGGCCCCTTCCTTCACCGAGG + Intronic
903207094 1:21790767-21790789 CACCGCACCTGGCCTCACCTGGG - Intergenic
904388348 1:30162176-30162198 AGGGGCTCCATGCCTCACCTGGG - Intergenic
904464460 1:30699682-30699704 CTGTGACCCTTTCCTCACCTGGG + Intergenic
911073079 1:93847360-93847382 CGGCCGCCCTTGGCTCAACTGGG + Intergenic
914375949 1:147073726-147073748 CGTCGGCCCTTGCCTGACCTTGG + Intergenic
914507278 1:148300725-148300747 TGTCGGCCCTTGCCTGACCTTGG - Intergenic
915456096 1:156041854-156041876 CTGCCCCCCTACCCTCACCTGGG + Exonic
915564296 1:156705335-156705357 AGCCCCCCCTTGCCCCACCTGGG + Intronic
915579260 1:156803731-156803753 CGCAGCCCCAGGCCTCACCTTGG + Intergenic
915733571 1:158070790-158070812 CCTCTCACCTTGCCTCACCTGGG + Intronic
919631568 1:199964937-199964959 CAGAGGCCCTAGCCTCACCTTGG + Intergenic
921373788 1:214452225-214452247 CGACTCCCCTTACCTCACATGGG - Intronic
1066732712 10:38449552-38449574 CTGAGCCCCTTGCCTCACACCGG + Intergenic
1066732761 10:38449748-38449770 CTGAGCCCCTTGCCTCACACCGG + Intergenic
1066732786 10:38449846-38449868 GGGAGCCCCTTGCCTCACACCGG + Intergenic
1066732799 10:38449895-38449917 CTGAGCCCCTTGCCTCACACCGG + Intergenic
1066732824 10:38449993-38450015 CTGAGCCCCTTGCCTCACACCGG + Intergenic
1066732850 10:38450091-38450113 AGGAGCCCCTTGCCTCACACCGG + Intergenic
1066732861 10:38450140-38450162 CTGAGCCCCTTGCCTCACACCGG + Intergenic
1066732875 10:38450189-38450211 GGGAGCCCCTTGCCTCACACCGG + Intergenic
1066732905 10:38450287-38450309 GGGAGCCCCTTGCCTCACACCGG + Intergenic
1066732930 10:38450385-38450407 CTGAGCCCCTTGCCTCACACCGG + Intergenic
1066732996 10:38450628-38450650 GGGAGCCCCTTGCCTCACACCGG + Intergenic
1067716965 10:48697359-48697381 CCTGGCCCCTGGCCTCACCTGGG + Intronic
1069849786 10:71397276-71397298 CGCCGCGCCTCGCCTCGCCTCGG - Intronic
1070330043 10:75409841-75409863 CGGCTCCCTTTTCCTCACCTGGG + Intergenic
1073332277 10:102678182-102678204 CGGCGCCACCGGCCTCATCTTGG - Intronic
1075871204 10:125773757-125773779 CGGCGCACCTACCCCCACCTCGG - Intronic
1076970219 11:128456-128478 GTGAGCCCCTTGCCTCACCCCGG - Intergenic
1077478103 11:2800446-2800468 CCACCCCACTTGCCTCACCTCGG + Intronic
1083356123 11:62067565-62067587 CGCCGCCCCTGTCTTCACCTTGG + Intergenic
1083763136 11:64829591-64829613 CGGCACCCAGTGCCTCACCCAGG + Exonic
1084219860 11:67671210-67671232 CTGCCCCACCTGCCTCACCTGGG - Intronic
1085350143 11:75793042-75793064 CTGAGCACCTTGCCTCTCCTGGG + Intronic
1089126099 11:116177684-116177706 TGGCTCCCCTTACCTCAGCTGGG - Intergenic
1089965973 11:122655494-122655516 CGGCGCCCCAGCCCTCTCCTTGG - Intergenic
1090402732 11:126459218-126459240 AGGAGGCCCTTCCCTCACCTGGG + Intronic
1091434221 12:460556-460578 CCGCGCCCTTCGCCTCCCCTGGG - Intronic
1092003802 12:5052065-5052087 CTGCACCCCTCTCCTCACCTTGG - Intergenic
1092083874 12:5739835-5739857 CAGCGCCACTTGCCTCATTTGGG + Intronic
1097185068 12:57192380-57192402 CGGTGCCCCTACCCTCACCCTGG + Intronic
1098024639 12:66189129-66189151 AGGCGCGCCTTGCGTCACGTGGG + Exonic
1100985574 12:100199458-100199480 CGGCGCTCCTTGCCTCCCCTGGG - Intronic
1102537417 12:113591678-113591700 CGGCGCTCCTGGGCTCACCGGGG + Intergenic
1104112473 12:125716890-125716912 CTGTGCCCCTTGCCTCAGCTTGG - Intergenic
1107559990 13:41550187-41550209 CGGGGCCTCTTCACTCACCTTGG - Intergenic
1113530453 13:111020660-111020682 CTGCGCCCTTTTCCTCACCACGG - Intergenic
1121529288 14:94641167-94641189 AGGCTCCCCTTGCCTCTCCTGGG - Intergenic
1128342291 15:66830947-66830969 CTGAGCCCCTTTCCTCATCTTGG + Intergenic
1128468513 15:67932715-67932737 CTGGGCCCCTTGCCTCAATTTGG + Intergenic
1128550611 15:68595920-68595942 CGCTGCTCCTTCCCTCACCTAGG - Intronic
1132111421 15:99104933-99104955 CAGCGCCCCCTGCCGCACCTTGG - Intronic
1132999859 16:2843792-2843814 AGGCACTCCTTGCCTCACCTGGG - Intergenic
1135002755 16:18790507-18790529 CGGCTCACCTTGCCTCTCCCAGG - Intronic
1139422282 16:66856120-66856142 AGGCGCCCCTGGCCTGATCTAGG + Intronic
1139490571 16:67283880-67283902 CTGCTCCCCTTCCCTCACCTAGG - Intronic
1140025827 16:71289467-71289489 CGGCGACTCTCGCCTCGCCTAGG + Exonic
1142450106 16:90169315-90169337 CCGAGCCCCTTGCCTCACACCGG + Intergenic
1142450130 16:90169412-90169434 GTGAGCCCCTTGCCTCACCCCGG + Intergenic
1142457153 17:63209-63231 GTGAGCCCCTTGCCTCACCCCGG - Intergenic
1143582583 17:7835494-7835516 CGGCTCCCCTTCCCTCCCCTGGG + Intergenic
1146052597 17:29565829-29565851 CCCGGCCCCTTGCCTCATCTCGG - Intronic
1151460173 17:74249672-74249694 CAGCAGCCCTGGCCTCACCTGGG - Intronic
1152502902 17:80724948-80724970 CCACGCCCCTTGCCTCCCCTGGG + Intronic
1152742382 17:82023985-82024007 GGGCGCCCCTTCCTGCACCTGGG + Intronic
1152845781 17:82598976-82598998 CGGCCTCCCGTGCCTCCCCTAGG + Intronic
1154173675 18:12067979-12068001 CTGCGGCCATTGCGTCACCTGGG + Intergenic
1156411022 18:36828665-36828687 CGTGCCCCCTTTCCTCACCTAGG + Exonic
1158896276 18:61916598-61916620 CCCCACCCCTGGCCTCACCTTGG - Intergenic
1159129135 18:64260047-64260069 GGGCATCCCTTGCCTAACCTAGG + Intergenic
1160647053 19:198519-198541 GTGAGCCCCTTGCCTCACCCCGG - Intergenic
1160647079 19:198616-198638 GTGAGCCCCTTGCCTCACCCCGG - Intergenic
1160647129 19:198810-198832 GTGAGCCCCTTGCCTCACCCCGG - Intergenic
1160647155 19:198907-198929 GTGAGCCCCTTGCCTCACCCCGG - Intergenic
1160647227 19:199195-199217 CCGAGCCCCTTGCCTCACACCGG - Intergenic
1160647265 19:199341-199363 GTGAGCCCCTTGCCTCACCCCGG - Intergenic
1160647291 19:199438-199460 GTGAGCCCCTTGCCTCACCCCGG - Intergenic
1160647341 19:199632-199654 GTGAGCCCCTTGCCTCACCCCGG - Intergenic
1160805237 19:989699-989721 CAGCCCCCCTTTCCTCCCCTGGG + Intronic
1165066144 19:33229712-33229734 CCCAGCCCCTAGCCTCACCTTGG + Intergenic
1167149632 19:47701494-47701516 CGGCTCCCCTTCGGTCACCTGGG + Exonic
1168407964 19:56120705-56120727 CGCGGCCCCTTCCCCCACCTGGG + Intronic
927393270 2:22620360-22620382 CTTCGCTCCTTGCCTCAGCTAGG - Intergenic
933666682 2:84970731-84970753 CGCCGCCCCTAGCCCCGCCTGGG - Intergenic
934653026 2:96103221-96103243 CCAGGCCCCTTGCCTCCCCTGGG - Intergenic
934774438 2:96928155-96928177 AGGCCCCCCTTCCCTCGCCTCGG - Intronic
935392924 2:102572185-102572207 GGGCGAGCATTGCCTCACCTGGG - Intergenic
937905055 2:127049096-127049118 CGGCTCCCCGTGACCCACCTGGG - Intronic
938139102 2:128782120-128782142 GGGCGGCCCTAGGCTCACCTGGG + Intergenic
946242868 2:218367628-218367650 CAGCGCCCCTTAGCTCTCCTTGG + Intronic
946640703 2:221780627-221780649 AGGGGCCCCTTCCCTCACCAAGG - Intergenic
946659520 2:221984741-221984763 GGGCGAGCATTGCCTCACCTGGG + Intergenic
947529307 2:230898722-230898744 CGGAGCCCCTGGCCCCAGCTGGG - Intergenic
1169077039 20:2767740-2767762 CTTCCCTCCTTGCCTCACCTTGG + Intergenic
1172232973 20:33349500-33349522 TGCCGCCACTTCCCTCACCTAGG - Intergenic
1175659031 20:60796471-60796493 CAGCTCCCCTTGCTTCCCCTGGG + Intergenic
1175926479 20:62474008-62474030 GGGCGCCCCTGGGCTCTCCTGGG + Intronic
1178662731 21:34521003-34521025 CCGCGGCCCTTCCCTCACCATGG + Intronic
1179726758 21:43345281-43345303 GGGCCCCTCTCGCCTCACCTTGG + Intergenic
1182447809 22:30399714-30399736 CAGCCCCTCTTCCCTCACCTCGG - Exonic
1183326966 22:37199522-37199544 CGGCGACCCTTGGCTCCACTCGG - Intergenic
1183326988 22:37199619-37199641 CGGCGCCCCCTGCCGGGCCTGGG + Intergenic
1184028612 22:41877428-41877450 GGAGGCCCCTTGCCCCACCTGGG + Intronic
1184730914 22:46370614-46370636 CTGTGCCCCTTGCCCCACCCTGG + Intronic
950650321 3:14402961-14402983 CGGCGCCCCTTTCACCACCGCGG + Intronic
950904602 3:16526275-16526297 CGGAGCCACCTGCCTCTCCTGGG - Intergenic
953981861 3:47417387-47417409 AGGCTCCCCTTCCCTCGCCTGGG - Exonic
954315459 3:49798976-49798998 GGCTGCCCCTGGCCTCACCTGGG + Exonic
956407293 3:68941166-68941188 CGCCCCCCCTTGCCCAACCTGGG - Intergenic
956982153 3:74651466-74651488 CGGCTCCACTTACCTCATCTTGG + Intergenic
957250858 3:77769478-77769500 GGGCGAGCATTGCCTCACCTGGG - Intergenic
962438498 3:135389484-135389506 CGGCACTCCTTGGCTCTCCTTGG - Intergenic
962604767 3:137024071-137024093 CAGTGCCCCTAGTCTCACCTGGG - Intergenic
966873710 3:184309180-184309202 CTGAGCCCCTTCCCTCCCCTGGG + Intronic
966883320 3:184361756-184361778 CAGCGCCCCTTGCCGCCTCTCGG - Intronic
968370505 3:198220521-198220543 CCGAGCCCCTTGCCTCACACCGG + Intergenic
968370530 3:198220619-198220641 CCGAGCCCCTTGCCTCACACCGG + Intergenic
968370603 3:198220907-198220929 GTGAGCCCCTTGCCTCACCCCGG + Intergenic
968370629 3:198221004-198221026 GTGAGCCCCTTGCCTCACCCCGG + Intergenic
969696129 4:8735878-8735900 CGCAGCCCCTTGGCCCACCTAGG - Intergenic
976246863 4:83013031-83013053 CGGCGCCTCGTCCCTCCCCTTGG + Intergenic
983600490 4:169521332-169521354 GGGCGAGCATTGCCTCACCTGGG - Intronic
1001033209 5:168277772-168277794 AGGCGAACCTTGCCCCACCTTGG + Intergenic
1001704012 5:173728890-173728912 CGGAGCCCCTGTCCTCGCCTGGG + Intergenic
1004424405 6:15497705-15497727 CTGGGCCCCTTGCTTCCCCTGGG + Intronic
1005994932 6:30925381-30925403 GGACCCGCCTTGCCTCACCTCGG - Exonic
1011640319 6:89411795-89411817 TCGCGCCCCTTTCCTCCCCTTGG - Intronic
1018148386 6:160915230-160915252 GGTCGCCCCATCCCTCACCTGGG - Intergenic
1020374062 7:7465271-7465293 GGGCGAGCATTGCCTCACCTGGG + Intronic
1021106725 7:16646300-16646322 CGGCGCCCCTTGCCTCACCTGGG - Exonic
1023755922 7:43416854-43416876 GGGCGAGCATTGCCTCACCTGGG - Intronic
1023816129 7:43951367-43951389 CTGCGGCCCCTGCCACACCTGGG - Intronic
1024248513 7:47488791-47488813 AGGAGCCCCCGGCCTCACCTGGG - Intronic
1027406523 7:77867657-77867679 CTGCGCCCTTTCCCCCACCTTGG - Intronic
1030696206 7:112588139-112588161 TGGCGGCCCTCCCCTCACCTAGG - Intergenic
1032051556 7:128653579-128653601 CTGAGCCCCTTGCCTCACACCGG + Intergenic
1032051570 7:128653628-128653650 CTGAGCCCCTTGCCTCACACCGG + Intergenic
1032344600 7:131106893-131106915 CGGCGCCCTTCGCCCCACCCAGG + Intergenic
1032540217 7:132696960-132696982 CGGCGCCCCCTCTCCCACCTTGG + Intronic
1034447933 7:151122937-151122959 CGGCGCTCCTAGCCTTCCCTGGG - Intronic
1039828299 8:41193343-41193365 CTGTGCCCCTGGGCTCACCTAGG + Intergenic
1061901903 9:133677386-133677408 CTGGGCCCCTGACCTCACCTGGG + Intronic
1203577980 Un_KI270745v1:22408-22430 GTGAGCCCCTTGCCTCACCCCGG + Intergenic
1203578049 Un_KI270745v1:22699-22721 CCGAGCCCCTTGCCTCACACCGG + Intergenic
1203578089 Un_KI270745v1:22846-22868 CCGAGCCCCTTGCCTCACACCGG + Intergenic
1203578160 Un_KI270745v1:23136-23158 CTGAGCCCCTTGCCTCACACCGG + Intergenic
1189366806 X:40395157-40395179 CCGGCCCCCTTGCCTCAACTGGG - Intergenic
1192264716 X:69530455-69530477 CAGCACACCTTGCCCCACCTGGG + Exonic
1200459986 Y:3443728-3443750 GGGCGAGCATTGCCTCACCTGGG + Intergenic
1202380816 Y:24275842-24275864 GGGAGCCCCTTGCCTCACATCGG + Intergenic
1202380829 Y:24275891-24275913 GGGAGCCCCTTGCCTCACACCGG + Intergenic
1202380843 Y:24275940-24275962 GGGAGCCCCTTGCCTCACACCGG + Intergenic
1202489941 Y:25394185-25394207 GGGAGCCCCTTGCCTCACACCGG - Intergenic
1202489955 Y:25394234-25394256 GGGAGCCCCTTGCCTCACACCGG - Intergenic
1202489968 Y:25394283-25394305 GGGAGCCCCTTGCCTCACATCGG - Intergenic