ID: 1021106726

View in Genome Browser
Species Human (GRCh38)
Location 7:16646301-16646323
Sequence ACGGCGCCCCTTGCCTCACC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 75}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021106726_1021106735 25 Left 1021106726 7:16646301-16646323 CCAGGTGAGGCAAGGGGCGCCGT 0: 1
1: 0
2: 0
3: 6
4: 75
Right 1021106735 7:16646349-16646371 GCCCCGCCGGGGTTTCCATCGGG 0: 1
1: 0
2: 0
3: 5
4: 55
1021106726_1021106731 13 Left 1021106726 7:16646301-16646323 CCAGGTGAGGCAAGGGGCGCCGT 0: 1
1: 0
2: 0
3: 6
4: 75
Right 1021106731 7:16646337-16646359 GTAGCGACTGCCGCCCCGCCGGG 0: 1
1: 0
2: 0
3: 7
4: 69
1021106726_1021106732 14 Left 1021106726 7:16646301-16646323 CCAGGTGAGGCAAGGGGCGCCGT 0: 1
1: 0
2: 0
3: 6
4: 75
Right 1021106732 7:16646338-16646360 TAGCGACTGCCGCCCCGCCGGGG 0: 1
1: 0
2: 0
3: 1
4: 40
1021106726_1021106734 24 Left 1021106726 7:16646301-16646323 CCAGGTGAGGCAAGGGGCGCCGT 0: 1
1: 0
2: 0
3: 6
4: 75
Right 1021106734 7:16646348-16646370 CGCCCCGCCGGGGTTTCCATCGG 0: 1
1: 0
2: 0
3: 3
4: 41
1021106726_1021106730 12 Left 1021106726 7:16646301-16646323 CCAGGTGAGGCAAGGGGCGCCGT 0: 1
1: 0
2: 0
3: 6
4: 75
Right 1021106730 7:16646336-16646358 AGTAGCGACTGCCGCCCCGCCGG 0: 1
1: 0
2: 0
3: 3
4: 25
1021106726_1021106739 29 Left 1021106726 7:16646301-16646323 CCAGGTGAGGCAAGGGGCGCCGT 0: 1
1: 0
2: 0
3: 6
4: 75
Right 1021106739 7:16646353-16646375 CGCCGGGGTTTCCATCGGGCAGG 0: 1
1: 0
2: 1
3: 1
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021106726 Original CRISPR ACGGCGCCCCTTGCCTCACC TGG (reversed) Exonic
903069639 1:20720798-20720820 AGGGGCCACCTTGCCTCACCAGG - Intronic
903780111 1:25815513-25815535 TCCGCCCCACTTGCCTCACCCGG + Intronic
904701766 1:32362154-32362176 ACGGTGCCCCCTGCCGCCCCTGG + Exonic
912381360 1:109249759-109249781 GCGGCGCCCCTGGCCTTGCCGGG - Intergenic
915733569 1:158070789-158070811 ACCTCTCACCTTGCCTCACCTGG + Intronic
918400905 1:184162160-184162182 AGGACTCCCCTTGCCCCACCAGG + Intergenic
1070330042 10:75409840-75409862 GCGGCTCCCTTTTCCTCACCTGG + Intergenic
1071206297 10:83283417-83283439 AAGGCTCCCCTTTCCTCAGCTGG + Intergenic
1080551463 11:33376568-33376590 TCGGCGCCCCGGTCCTCACCGGG - Intergenic
1082009015 11:47438047-47438069 ACAGGGCCCTTTGCCTCCCCAGG - Exonic
1083650860 11:64203920-64203942 TCGGCGCCCCGGGCCTCGCCAGG + Intronic
1084553249 11:69861545-69861567 AGGGCTCCTCTTGCTTCACCTGG + Intergenic
1085310998 11:75516570-75516592 TCTGCTCCCCTTGCCCCACCAGG - Intronic
1096823857 12:54259361-54259383 ATGGCCTCCCCTGCCTCACCAGG + Intronic
1100985575 12:100199459-100199481 TCGGCGCTCCTTGCCTCCCCTGG - Intronic
1102537416 12:113591677-113591699 GCGGCGCTCCTGGGCTCACCGGG + Intergenic
1107791362 13:44005391-44005413 AGAGCACCCCTTGCCTCAACAGG + Intergenic
1111607887 13:90564124-90564146 AGTGGGCCCCTTGCCTCATCAGG - Intergenic
1116834579 14:49757843-49757865 ACCGCGCCCGGTGCCACACCTGG - Intergenic
1116967380 14:51028929-51028951 CTGGCTCCCCTTGCCTCCCCAGG + Intronic
1119717260 14:76867747-76867769 ACGGCTCCTCTCACCTCACCAGG - Intronic
1121529289 14:94641168-94641190 AAGGCTCCCCTTGCCTCTCCTGG - Intergenic
1121803936 14:96797764-96797786 ACGCCGCCTCGGGCCTCACCGGG + Intronic
1122131092 14:99604766-99604788 ACGGCGCCCCTTCTCCCTCCCGG + Intergenic
1122781842 14:104147050-104147072 ACGGGGCCCCTTGGTTCACCCGG + Intronic
1129849991 15:78788269-78788291 ACGACGCCGCTCCCCTCACCTGG - Exonic
1130252262 15:82307304-82307326 ACGACGCCGCTCCCCTCACCTGG + Intergenic
1132999860 16:2843793-2843815 CAGGCACTCCTTGCCTCACCTGG - Intergenic
1134025429 16:10949493-10949515 ACTGCTCCCCTTGCCCCACTAGG - Intronic
1136367619 16:29816217-29816239 ACGACGCCCCTCTCCACACCCGG - Exonic
1137737360 16:50734908-50734930 ACCACGCTCCTTCCCTCACCAGG - Intergenic
1139952404 16:70678746-70678768 ATGGCGCCCCTCACCTCACAAGG + Intronic
1142172670 16:88630976-88630998 AGGGAGCCCCTTGCCTGTCCTGG + Intronic
1143582582 17:7835493-7835515 TCGGCTCCCCTTCCCTCCCCTGG + Intergenic
1144274658 17:13653917-13653939 ACTGTGCCCCTTGGCACACCTGG + Intergenic
1145996679 17:29108831-29108853 CAGGCCCCCCTTCCCTCACCCGG - Intronic
1146428604 17:32768215-32768237 AGGGCCCGCCTTGCCTCACCTGG - Intronic
1146666528 17:34708682-34708704 ACGGTGCCACTTTCCTGACCAGG - Intergenic
1152502900 17:80724947-80724969 ACCACGCCCCTTGCCTCCCCTGG + Intronic
1160682881 19:419942-419964 ACAGGGCCCCCAGCCTCACCCGG - Intronic
1161593905 19:5141688-5141710 CCGGAGCCCCCTGACTCACCAGG - Intronic
1162452121 19:10761498-10761520 ACGGAGACCCTTACCTCTCCCGG - Intronic
1166748590 19:45153858-45153880 TGGGCGCCCCTCGCCTCTCCAGG - Intronic
933666683 2:84970732-84970754 ACGCCGCCCCTAGCCCCGCCTGG - Intergenic
935392925 2:102572186-102572208 AGGGCGAGCATTGCCTCACCTGG - Intergenic
937905056 2:127049097-127049119 ACGGCTCCCCGTGACCCACCTGG - Intronic
938139101 2:128782119-128782141 AGGGCGGCCCTAGGCTCACCTGG + Intergenic
946659519 2:221984740-221984762 AGGGCGAGCATTGCCTCACCTGG + Intergenic
1172597200 20:36157622-36157644 AAAGCCACCCTTGCCTCACCAGG - Intronic
1175424570 20:58855402-58855424 GCGGAGCCCCTAGCCCCACCAGG - Intronic
1175469802 20:59219409-59219431 CCGGCTCCCCTTGCCACACTGGG - Intronic
1183515986 22:38266389-38266411 ATAGCGCCCCTTGCCTTAGCAGG + Intronic
953981862 3:47417388-47417410 AAGGCTCCCCTTCCCTCGCCTGG - Exonic
957250859 3:77769479-77769501 AGGGCGAGCATTGCCTCACCTGG - Intergenic
966873709 3:184309179-184309201 ACTGAGCCCCTTCCCTCCCCTGG + Intronic
969364178 4:6684596-6684618 ACGGCCCCCCTTTCCTGAGCTGG + Intergenic
969423912 4:7112731-7112753 AGGGAGCTCCTTGCCTGACCAGG + Intergenic
983600491 4:169521333-169521355 AGGGCGAGCATTGCCTCACCTGG - Intronic
991707228 5:69369608-69369630 GCGGCGCCCCTAGCCTGCCCCGG + Intronic
1004396381 6:15248961-15248983 ACGGCTCCCCGGCCCTCACCTGG - Intronic
1007995735 6:46305966-46305988 ACTGAGCACCTTGGCTCACCAGG - Intronic
1012338747 6:98092025-98092047 AAGGTGCCCCTAGCCTTACCAGG - Intergenic
1018148387 6:160915231-160915253 AGGTCGCCCCATCCCTCACCTGG - Intergenic
1018649261 6:165978087-165978109 CCTGTGCCCCTTGCCTCATCAGG - Intronic
1018813455 6:167314385-167314407 ACCGCACACCCTGCCTCACCGGG + Intronic
1019749140 7:2717978-2718000 ACGGCGGCCCCTGCCTCCCCCGG + Intronic
1020374061 7:7465270-7465292 AGGGCGAGCATTGCCTCACCTGG + Intronic
1021106726 7:16646301-16646323 ACGGCGCCCCTTGCCTCACCTGG - Exonic
1023755923 7:43416855-43416877 AGGGCGAGCATTGCCTCACCTGG - Intronic
1023816130 7:43951368-43951390 ACTGCGGCCCCTGCCACACCTGG - Intronic
1032834418 7:135660148-135660170 ACGGGGCTCCCTGCCCCACCTGG + Intergenic
1048385848 8:133912082-133912104 CTGGGGCCCCTTGCTTCACCTGG + Intergenic
1051938333 9:22471910-22471932 ACAGAGCCACTTCCCTCACCAGG + Intergenic
1053680613 9:40483229-40483251 ACGGTGGCCCCTGCCTCACGGGG - Intergenic
1054283099 9:63141706-63141728 ACGGTGGCCCCTGCCTCACGGGG + Intergenic
1054391719 9:64623233-64623255 ACGGTGGCCCCTGCCTCACGGGG - Intergenic
1054504008 9:65893095-65893117 ACGGTGGCCCCTGCCTCACGGGG + Intronic
1059168740 9:112104305-112104327 ACCACGCCCCTAACCTCACCAGG + Intronic
1061682654 9:132250586-132250608 ACGGCGCCCCCTGCATTTCCAGG + Intergenic
1189366808 X:40395158-40395180 ACCGGCCCCCTTGCCTCAACTGG - Intergenic
1199344134 X:146719225-146719247 AGGGCTTCCGTTGCCTCACCAGG + Intergenic
1200459985 Y:3443727-3443749 AGGGCGAGCATTGCCTCACCTGG + Intergenic