ID: 1021106734

View in Genome Browser
Species Human (GRCh38)
Location 7:16646348-16646370
Sequence CGCCCCGCCGGGGTTTCCAT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 41}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021106729_1021106734 5 Left 1021106729 7:16646320-16646342 CCGTGAGGGTTGCGAGAGTAGCG 0: 1
1: 0
2: 1
3: 2
4: 32
Right 1021106734 7:16646348-16646370 CGCCCCGCCGGGGTTTCCATCGG 0: 1
1: 0
2: 0
3: 3
4: 41
1021106725_1021106734 25 Left 1021106725 7:16646300-16646322 CCCAGGTGAGGCAAGGGGCGCCG 0: 1
1: 0
2: 1
3: 11
4: 150
Right 1021106734 7:16646348-16646370 CGCCCCGCCGGGGTTTCCATCGG 0: 1
1: 0
2: 0
3: 3
4: 41
1021106726_1021106734 24 Left 1021106726 7:16646301-16646323 CCAGGTGAGGCAAGGGGCGCCGT 0: 1
1: 0
2: 0
3: 6
4: 75
Right 1021106734 7:16646348-16646370 CGCCCCGCCGGGGTTTCCATCGG 0: 1
1: 0
2: 0
3: 3
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021106734 Original CRISPR CGCCCCGCCGGGGTTTCCAT CGG Intronic
902300001 1:15494968-15494990 CGTGCCTCAGGGGTTTCCATGGG - Intronic
903338251 1:22638893-22638915 CACCTTGCCGGGGTTTCCAGAGG - Exonic
915325716 1:155080407-155080429 CCCACCCCCGAGGTTTCCATGGG - Intronic
916107710 1:161443036-161443058 CTGCCCGCCGGGGTCTCCAGGGG - Intergenic
916109294 1:161450409-161450431 CTGCCCGCCGGGGTCTCCAGGGG - Intergenic
916110881 1:161457840-161457862 CTGCCCGCCGGGGTCTCCAGGGG - Intergenic
916112467 1:161465200-161465222 CTGCCCGCCGGGGTCTCCAGGGG - Intergenic
916114052 1:161472617-161472639 CTGCCCGCCGGGGTCTCCAGGGG - Intergenic
1063981498 10:11455694-11455716 AGGCCTGCTGGGGTTTCCATAGG - Intronic
1084909121 11:72373340-72373362 CGCCCAGCCGGGGTTGCCGCTGG - Intronic
1121224196 14:92309378-92309400 CGCCCCCTCGGGTTTTCTATGGG + Intergenic
1122267923 14:100555262-100555284 CACCCAGCCCGGGTTTCCACAGG - Intronic
1122829394 14:104388374-104388396 CGCCCCGTCGGCGACTCCATCGG + Intergenic
1128651184 15:69414694-69414716 CGCCCCGCCTGGGCCTCCAAGGG + Intronic
1137248743 16:46727813-46727835 CACCCCGCCGGGCCTGCCATTGG + Intronic
1161306604 19:3572552-3572574 GGCCCCGCCCCGGTTGCCATGGG - Intronic
1165665229 19:37622217-37622239 TGCCCCTCCGTGCTTTCCATTGG + Intronic
1167262567 19:48467403-48467425 AGCCCAGCCTGGGTTTCCACTGG + Intronic
928176294 2:29036493-29036515 TGCCCAGCCTGGGTTCCCATGGG + Intronic
935632458 2:105223402-105223424 CACCCGGCTGTGGTTTCCATGGG - Intergenic
938083834 2:128385267-128385289 CGGCCCGCCGTGGTTTCCAGAGG - Intergenic
944413553 2:199463398-199463420 CGACCCGCCGCGTTTTCCTTAGG + Intronic
945032886 2:205682105-205682127 CGTCCCCCCGGGGTCTCCCTTGG + Intronic
948077271 2:235174634-235174656 CACCCCACAGGGGTTTCCTTGGG + Intergenic
949070116 2:242019389-242019411 CGCCCCGCCGGCCTTTGCACAGG - Intergenic
1172977553 20:38918329-38918351 GGCCACGCCAGGGTTGCCATAGG - Exonic
1179225067 21:39445776-39445798 CCCCGCGCGCGGGTTTCCATGGG - Intronic
1181390776 22:22579385-22579407 CACACAGCAGGGGTTTCCATGGG + Intergenic
1184684068 22:46088100-46088122 CCCCCCACCGTGGTTTCCATGGG - Intronic
950660375 3:14463516-14463538 AGCCCCGCAGGGGTCTCCAGAGG - Intronic
951544548 3:23811008-23811030 CGCCCTGCCGGGGTGGGCATGGG + Intronic
975683491 4:76897910-76897932 CGCCCGGCCAGGGTTTCCTCTGG - Exonic
998452670 5:142246771-142246793 CTCCCAGCCAGAGTTTCCATGGG - Intergenic
1001924619 5:175627191-175627213 GGCCTCGGCGGGGTTTCCCTAGG + Intergenic
1006787627 6:36679084-36679106 CGCCCCAGCTGGGTTTCCAGGGG - Intronic
1006813353 6:36835115-36835137 CGCCCCGCCGCGTCTTCCCTGGG + Intronic
1018705784 6:166462251-166462273 TGCCCCACCGGGGGTTCCATGGG - Intronic
1019355960 7:579111-579133 CGCCCGTCCGGGGCCTCCATGGG - Intronic
1019435823 7:1021657-1021679 CGACCTGCCGGGGTTCCCAGAGG - Intronic
1021106734 7:16646348-16646370 CGCCCCGCCGGGGTTTCCATCGG + Intronic
1045222670 8:100213642-100213664 GTCCCCGCCGGGTTTTCCCTTGG + Intronic
1049810071 8:144562739-144562761 CGCACCCCAGTGGTTTCCATTGG + Intronic
1049861178 8:144900803-144900825 TGCGCCGCCGGGGTCTTCATGGG + Intronic
1053363217 9:37504272-37504294 CACACTGCCGGGGTTGCCATCGG + Intergenic
1062517595 9:136944188-136944210 CGTCCCGCCGGGAGTTCCACGGG + Intronic