ID: 1021107357

View in Genome Browser
Species Human (GRCh38)
Location 7:16653172-16653194
Sequence AGGAAGCTCAAAGGTGGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 394
Summary {0: 1, 1: 2, 2: 2, 3: 36, 4: 353}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021107357 Original CRISPR AGGAAGCTCAAAGGTGGTGG TGG (reversed) Intronic