ID: 1021107625

View in Genome Browser
Species Human (GRCh38)
Location 7:16656540-16656562
Sequence GTGTGTGCGCGCGCGCGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 487
Summary {0: 1, 1: 3, 2: 37, 3: 100, 4: 346}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021107625_1021107628 18 Left 1021107625 7:16656540-16656562 CCCCAGCGCGCGCGCGCACACAC 0: 1
1: 3
2: 37
3: 100
4: 346
Right 1021107628 7:16656581-16656603 ACACACACACACACACAAGTAGG 0: 16
1: 250
2: 1511
3: 5832
4: 6629

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021107625 Original CRISPR GTGTGTGCGCGCGCGCGCTG GGG (reversed) Intronic
900406151 1:2493921-2493943 GTGTGTGCAGGGGCGTGCTGTGG + Intronic
901361388 1:8703506-8703528 GTGTGTGCGCGCGCCCGCGGCGG - Intronic
901443876 1:9295236-9295258 GTGTGTGCGCGCGTGCGGTTGGG + Intronic
901660147 1:10794197-10794219 GTGCGCGCGCGCGCGCGTCGTGG + Intronic
901762661 1:11480662-11480684 GTGTGTGCACGCGCGCGCTGGGG - Intronic
901762663 1:11480664-11480686 GTGTGTGTGCACGCGCGCGCTGG - Intronic
901905022 1:12400951-12400973 GTGTGTGTGTGCGCGCGCGCAGG - Intronic
902451435 1:16499170-16499192 GGGGGTGCGCGCGTGCGCGGGGG - Intergenic
903353571 1:22732528-22732550 CTGTGTGCACACGCGCACTGAGG - Intronic
903750343 1:25617249-25617271 GGGTGTGCGCGCGCTCGGGGCGG + Intergenic
903750489 1:25617731-25617753 GTGTCTGCGGGGGCGCGGTGAGG - Exonic
904837733 1:33349842-33349864 GGTTGCGCGCGCGCGCGCGGCGG + Intronic
904847475 1:33430948-33430970 GGGCGGGCGCGTGCGCGCTGGGG - Intronic
905037687 1:34928710-34928732 GCGTGTGCGCGCGCGTGCGTTGG - Intronic
905205049 1:36338686-36338708 GTGTGTCCGCGTGGGTGCTGTGG + Intergenic
907118314 1:51989092-51989114 GTGTGTGTGTGCGCGCGCACAGG - Intronic
907526476 1:55056863-55056885 GTGCGTGCGCGCGCGCGCGTTGG + Intronic
907526478 1:55056865-55056887 GCGTGCGCGCGCGCGCGTTGGGG + Intronic
907645155 1:56235087-56235109 GTGTGTGTGTGCGCGCACTCAGG + Intergenic
907656797 1:56351552-56351574 GTGTGTGTGCTCGTGCGCTGGGG + Intergenic
908252903 1:62279183-62279205 GTGTGTGCGCGCGCTAGCTTAGG - Intronic
908461180 1:64349703-64349725 GTGTGTGTGTGTGCGCCCTGGGG + Intergenic
908713019 1:67039511-67039533 GTGTGTGTGTGCGCGCGTGGGGG + Intronic
910105164 1:83624309-83624331 GTGTGTGTGCGCGTGCCCAGAGG + Intergenic
912435176 1:109656580-109656602 GTGTGTGTGTGCGTGCGCCGGGG + Intronic
912453910 1:109785287-109785309 GTGTGTGAGTGTGCGCGCTGAGG + Intergenic
912556455 1:110519734-110519756 GTGTGTGTGCGCGCGCACGCTGG + Intergenic
912684243 1:111749444-111749466 GTGCGCGCGCGCGCGTGCTAGGG + Intronic
913319408 1:117577907-117577929 GTGTGCGCGCGCGCGCAATGAGG + Intergenic
914869118 1:151458807-151458829 GAGTGCGCGCGCGCGCGCCGCGG + Intronic
915722086 1:157993222-157993244 GTATGTGTGTGCGCGCGTTGTGG + Intergenic
917565382 1:176207269-176207291 GTGCGCGCGCGCGCGAGCGGCGG + Exonic
918995793 1:191757538-191757560 GTGTGTGCGCGCGCGTGGGTGGG - Intergenic
918995795 1:191757542-191757564 GTGTGTGTGTGCGCGCGCGTGGG - Intergenic
919641904 1:200053554-200053576 GTGTGTGCGTGTGCATGCTGGGG - Intronic
919930009 1:202215015-202215037 GTGTGTGCGCGCGCGCGCGTTGG + Intronic
920524997 1:206659793-206659815 GTGTGTGCGCGCGCACGCACCGG - Intronic
921217730 1:212951450-212951472 GTGTGCGCGCGGGCGCGGCGAGG - Exonic
921708023 1:218346039-218346061 GTGTGCGTGTGCGCGCGCTGGGG - Intergenic
921708025 1:218346041-218346063 GTGTGTGCGTGTGCGCGCGCTGG - Intergenic
922648720 1:227318511-227318533 GTGTGCGCGCGCGTGTGCCGGGG - Intergenic
922817256 1:228458676-228458698 GTGTGTGTGCGCGCGCGCGCCGG + Exonic
923333951 1:232950783-232950805 GGGTGGGGGCGCGCGGGCTGCGG + Intronic
923783230 1:237043297-237043319 GTGTGCGCGCGCGCGGGTGGTGG + Intronic
924799340 1:247316229-247316251 GTGTGTGTGAGCGCGCGCAGTGG + Intronic
924799342 1:247316231-247316253 GTGTGTGAGCGCGCGCAGTGGGG + Intronic
924838422 1:247679514-247679536 GTGTGTGTGTGTGCGCGCTATGG + Intergenic
1062794922 10:337622-337644 GTGTGTGCGCACGTGTGTTGTGG + Intronic
1063062495 10:2571077-2571099 GTGTGTGAGAGCATGCGCTGTGG + Intergenic
1063114970 10:3067041-3067063 GTGAGTGGGCGCGAGCGCCGGGG - Intronic
1063624806 10:7679009-7679031 GTGTGTGCGCGCGCGCGCGGAGG - Intergenic
1063888970 10:10609447-10609469 GTGTGTGTGTGCACGCGCGGTGG - Intergenic
1063928891 10:11009355-11009377 GTGTGTGTGCGTGCGCGCGTCGG + Intronic
1065099696 10:22321160-22321182 GTGTGTGTGCGTGCGAGCGGGGG - Intronic
1067650713 10:48152947-48152969 GTGTGTGTGCGCGCGCGTGTGGG - Intergenic
1068519797 10:58065621-58065643 GTGTGTGCGCGCGCGTGTTTAGG + Intergenic
1068660916 10:59622577-59622599 GTGTGTGTGTGCGCGCGCGCGGG - Intergenic
1069653693 10:70071089-70071111 GTGTGTGCGCGTGTGCACAGGGG + Intronic
1070488586 10:76954260-76954282 GTGTGTGTGTGTGCACGCTGGGG - Intronic
1071526874 10:86364294-86364316 CTGTGTGCACGTGTGCGCTGAGG - Intronic
1072542375 10:96407809-96407831 GTGTGTGTGCGCGCACGCGTGGG + Intronic
1072881252 10:99232194-99232216 GTATGCGCGCGCGCGCGTTGGGG - Intronic
1072881254 10:99232196-99232218 GTGTATGCGCGCGCGCGCGTTGG - Intronic
1072930710 10:99659593-99659615 GTGTGGGCGCGAGAGGGCTGTGG + Intronic
1073325736 10:102643392-102643414 GGGTCTGGGCGCGCTCGCTGAGG - Intergenic
1073326219 10:102645196-102645218 GTGTGTGCGCGCGCGCGCGTAGG - Intronic
1073392586 10:103192263-103192285 GTGTGTGCGCGCCCGTCCAGGGG - Intronic
1073463755 10:103681757-103681779 GTGTGTGCGCGCGCGCGCGCGGG - Intronic
1074046400 10:109843505-109843527 GTGTGTGTGCGCGTGCACTTAGG - Intergenic
1074618348 10:115093045-115093067 GGGTGGGCGCGCGCGCGTGGGGG + Intergenic
1074810204 10:117096994-117097016 GTGCGCGCGCGTGCGCGCTTGGG - Intronic
1076120589 10:127934011-127934033 GTGTGTGTGCGCGGGGGGTGGGG - Intronic
1076670959 10:132120921-132120943 GTGTGTGGCCGCTCGAGCTGCGG + Intronic
1077459831 11:2703482-2703504 GTGTGTGCGTGCGTGCTCTCGGG - Intronic
1078063174 11:8061349-8061371 GTGTGTGGGGGCGTGTGCTGTGG + Intronic
1078090800 11:8263267-8263289 GTGTGTGTGCCTGCGCGCCGCGG + Intronic
1078594637 11:12675138-12675160 GTGTGTGCGCGTGCAGGCGGCGG - Intronic
1078823500 11:14905777-14905799 GTGTGTTCGGGCGCGCGTTGGGG + Intronic
1079798163 11:24833699-24833721 GTGTGTGTGCGCGCGCGCGGTGG - Intronic
1081804140 11:45881027-45881049 GTGTGTGTGCGCGTGTGCAGAGG + Exonic
1082035554 11:47642567-47642589 GCGTGCGTGCGCGCGCGCCGCGG - Exonic
1083436445 11:62646637-62646659 GTGGCTGAGCGCGCGCGATGGGG - Intronic
1083574313 11:63778464-63778486 GTGTGTGTGTGCGCGCGCGCGGG + Intergenic
1083753618 11:64777798-64777820 TCGAGTGCGCACGCGCGCTGTGG - Intronic
1083890292 11:65592500-65592522 GGGTGTGTGCGCGCTCGCGGCGG + Exonic
1084285103 11:68125903-68125925 GTGTGTGCGCGCGCGCGTTATGG - Intergenic
1086980937 11:93197533-93197555 GTGTTTGCGCGCGCGCGTGTGGG - Intronic
1089777599 11:120849152-120849174 GTGTGTGTGTGCGCGCGTTGGGG - Intronic
1089977444 11:122744897-122744919 GTGCGCGCGCGCGCGCACTTGGG + Intronic
1091023852 11:132124617-132124639 GTGTGTGCGCGCGCACGCGCAGG + Intronic
1092655044 12:10674872-10674894 GTGCGCGCGCGCGCGCGCGCGGG - Intergenic
1093547839 12:20369205-20369227 GTGTGTGCGCGCGCGCGCGTGGG + Intergenic
1094041471 12:26124947-26124969 GTGTGTGTGTGCGAGCGCGGTGG - Exonic
1095692845 12:45110218-45110240 GTGTGTGCGCGCACGGGGGGTGG - Intergenic
1095692847 12:45110222-45110244 GTGTGTGTGTGCGCGCACGGGGG - Intergenic
1096242677 12:49967674-49967696 GTGTGTGCGCGCGTGTGCACGGG - Intronic
1096481107 12:51941569-51941591 GTGTGTGCGCGCGCGCGCGTGGG - Intergenic
1097195520 12:57240558-57240580 GTGTGTGTGTGCGCGCGCCGGGG - Intronic
1098350782 12:69557618-69557640 GTGCGCGCGCGCGCGCGCGCAGG + Intronic
1098392510 12:69984514-69984536 GTGTGTGTGTGCGCGCACGGGGG - Intergenic
1099989784 12:89709397-89709419 GTGCGCGCGCGCGCGCGCGGAGG + Intergenic
1101640575 12:106583586-106583608 GTGTGCGTGCGCGCGCGCGAAGG + Intronic
1101641255 12:106586971-106586993 GTGTGTGTGTGCGCGCGCGCGGG + Intronic
1101966307 12:109284571-109284593 GCGTGTGTGTGTGCGCGCTGTGG + Intronic
1101966339 12:109284781-109284803 GTGTGTGTGCGCACATGCTGTGG + Intronic
1101966403 12:109285265-109285287 GTGTGTGTGTGCGCGCACTGCGG + Intronic
1102530843 12:113545517-113545539 GTGTGTGTGCACGCGTGCTCTGG + Intergenic
1102677249 12:114667322-114667344 GTGTGCGCGCTCGCGCGATTAGG - Intergenic
1103560942 12:121793129-121793151 GTGAGTGCGCCTGCGCGCCGGGG - Intronic
1103971728 12:124676810-124676832 GTGTGTGCGCGTGCACGCGCGGG + Intergenic
1105323263 13:19347223-19347245 GTGTGTGCGCGCACTTGGTGGGG - Intergenic
1105437925 13:20392355-20392377 TGGTGTGCGGGCGGGCGCTGCGG - Intergenic
1105438119 13:20394631-20394653 GTGTGTGTCCGCGCGCGCTCAGG - Intergenic
1105578652 13:21674505-21674527 GGGTGTGCGCGGGAGCGCGGCGG + Intronic
1105969910 13:25419083-25419105 GTGTGTGCACGCACGTGTTGAGG + Intronic
1106132300 13:26950658-26950680 GTGTGTGCGTGTGTGTGCTGTGG - Intergenic
1107045047 13:35984882-35984904 GTGTGTGCATGCGCACGCTGGGG - Intronic
1107359464 13:39603142-39603164 GTGGGCGCGCGCGGGCGCCGGGG + Exonic
1107459236 13:40585330-40585352 GTGTGTGTGCGCGCGCGCAGAGG - Intronic
1108530891 13:51326038-51326060 GTGTGTGCGCGCGCGCACGTGGG + Intergenic
1110922491 13:81106116-81106138 GTGTGCGCGCGTGCGCGCACAGG - Intergenic
1111343437 13:86917682-86917704 GTGTGTGCGCGCGCACGTGGTGG - Intergenic
1111950251 13:94704034-94704056 ATGTGTGCGCGCGCGCGTGAAGG + Intergenic
1112508764 13:99990827-99990849 GTGTGTGTGCGCGCGCGCAAAGG - Intergenic
1112509429 13:99997064-99997086 GTGTGCGCGCGCGCGCCCCTGGG + Intergenic
1113653938 13:112056727-112056749 GTGTGCGCGCGCGCGAGGCGAGG + Intergenic
1113667444 13:112150765-112150787 GTGTGTGTGTGCGCTTGCTGTGG - Intergenic
1113667518 13:112151088-112151110 GTGTGTGTGCGCGCTTGCCGTGG - Intergenic
1113733185 13:112657260-112657282 GTGTGTGTGCGCGCCCTGTGTGG - Intronic
1114612752 14:24053045-24053067 GTGTGCACGCGCGTGTGCTGGGG - Intronic
1115573400 14:34688052-34688074 GTGTGTGTGTGGGGGCGCTGGGG + Intergenic
1117721910 14:58637226-58637248 GTGCGCGCGCGTGCGCGCTTTGG - Intronic
1118323157 14:64765036-64765058 GTGTGTGCGCGCGCGCGCGCGGG + Intronic
1119325275 14:73756296-73756318 GCGCGCGCGCGTGCGCGCTGAGG + Intronic
1119539318 14:75428255-75428277 GGGTGCGAGGGCGCGCGCTGGGG + Intronic
1120497409 14:85254067-85254089 GTGTGTGTGCGCGCGTTGTGGGG - Intergenic
1120497411 14:85254069-85254091 GTGTGTGTGTGCGCGCGTTGTGG - Intergenic
1120834582 14:89028021-89028043 GTGTGCGCGCGCGCGCGGACAGG - Intergenic
1121120884 14:91375267-91375289 GTGTGTGCGCGCGCGCATGTGGG + Intronic
1122265916 14:100546761-100546783 GTGCGCGCGCGCGCGCGCGCCGG - Intronic
1122418330 14:101560826-101560848 GTGTGAGCGCGCGCGGGAGGCGG + Intergenic
1122993334 14:105249105-105249127 GTGGGCGCGCGCGGGCGCGGGGG - Intronic
1123037941 14:105478901-105478923 TTGTGGGCACGCGCGGGCTGGGG + Intronic
1126348117 15:47717783-47717805 GTGTGTGTGTGTGCGCGCGGTGG + Intronic
1126348119 15:47717785-47717807 GTGTGTGTGTGCGCGCGGTGGGG + Intronic
1126725043 15:51622985-51623007 GTTTGCGCGTGCGCGCGCCGTGG + Intergenic
1126800838 15:52295475-52295497 GGGCGGGCGGGCGCGCGCTGGGG - Intronic
1128454214 15:67823530-67823552 GGCTGTGCGCGCGCGCGGGGAGG + Intronic
1128582788 15:68820623-68820645 GTGTGTGTGTGTGCGCGCTGGGG - Intronic
1128791140 15:70434715-70434737 GTGTGCGCGCGCGCGCGCGCGGG - Intergenic
1129351228 15:74956916-74956938 GCGTGGGAGCGGGCGCGCTGCGG + Exonic
1129741243 15:77990656-77990678 GTGTGTGCGCGCGCATGTTGGGG - Intronic
1130154129 15:81334884-81334906 GGGTGTGCCCGAGTGCGCTGAGG + Exonic
1130371060 15:83285240-83285262 GTGTGTGTGCGTGTGCGGTGGGG - Intergenic
1131694237 15:94857650-94857672 GTGTGTGTGCGCGCGCACATGGG + Intergenic
1131784842 15:95901279-95901301 GTGTGTGCGCACACGCGTGGGGG + Intergenic
1131956130 15:97738214-97738236 GTGTGTGAGTGCGGGCACTGTGG + Intergenic
1132460905 16:54059-54081 GTGTGTGCGGGCGGGGGCTGGGG + Intronic
1132505933 16:308726-308748 GTGTGTGCGTGCTTGTGCTGTGG - Intronic
1132580078 16:680685-680707 GTGAGTGCGCCCGCGCGGGGAGG + Intronic
1133924261 16:10181172-10181194 GTGTGTGCACGCGCGCGTGTAGG - Intronic
1134203653 16:12219905-12219927 GTGTGTGCGCTGGGGGGCTGTGG - Intronic
1135037738 16:19092171-19092193 GTGTGTGTGCGCGCGCGCATTGG + Intergenic
1135656685 16:24256282-24256304 GTGTGCGAGCGCGTGTGCTGGGG - Exonic
1136855781 16:33656038-33656060 GTGTGTGTGCGCGCGCATAGCGG - Intergenic
1136925919 16:34374097-34374119 GTGTGTGTGTGCGCGCTTTGAGG + Intergenic
1136978655 16:35037709-35037731 GTGTGTGTGTGCGCGCTTTGAGG - Intergenic
1138116082 16:54361816-54361838 GTGTGTGTGCGTGCACGCTCAGG + Intergenic
1138116084 16:54361818-54361840 GTGTGTGCGTGCACGCTCAGGGG + Intergenic
1138229076 16:55324624-55324646 GAGAGTGCGCGCGCGCGCACGGG + Exonic
1138940078 16:61779457-61779479 GTGTGTGTGCGCGCATGGTGAGG + Intronic
1139467112 16:67159902-67159924 GGGTGTGCGCGGAGGCGCTGGGG + Exonic
1140927800 16:79600049-79600071 GTGTGTGTGAGCGCGCTCGGAGG - Exonic
1141582830 16:85011809-85011831 GTGTGTACCCGCGCCCGCGGCGG + Intergenic
1141618060 16:85221303-85221325 GTGTGTGTGTGTGCGCGCTAGGG - Intergenic
1141647277 16:85374540-85374562 GTGTGCGCGCGCGCGTGCACAGG + Intergenic
1141983420 16:87563866-87563888 GTGTGTGCGCGTGTGTGTTGGGG + Intergenic
1141983429 16:87563992-87564014 GTGTGTGTGCGCGTGTGTTGGGG + Intergenic
1141990212 16:87604985-87605007 GTGTGTGTGCGCGCGCGTGCAGG + Intronic
1142163231 16:88570288-88570310 GCGGGTCCGGGCGCGCGCTGCGG + Intergenic
1142332718 16:89465498-89465520 ATGTGTGCGGGCGGGCGGTGTGG - Intronic
1142351330 16:89582069-89582091 GTGTGTGAGCACGTGTGCTGTGG + Intronic
1203117366 16_KI270728v1_random:1504519-1504541 GTGTGTGTGCGCGCGCATAGCGG - Intergenic
1143102603 17:4512638-4512660 GTGTGTGCGTGCGCGCGCACGGG + Intronic
1143494947 17:7307521-7307543 GTGTGTGCGCTTGCGCAGTGCGG + Intronic
1144172835 17:12676230-12676252 GTGTGTGCGTGCGCGCGCAGGGG - Intronic
1144172837 17:12676232-12676254 GTGTGTGTGCGTGCGCGCGCAGG - Intronic
1144684385 17:17216357-17216379 GTGCGTGCCCCCGCGGGCTGTGG - Intronic
1144757146 17:17686601-17686623 GTGTGTGTGCACGCGCGCGCCGG + Intronic
1144757148 17:17686603-17686625 GTGTGTGCACGCGCGCGCCGGGG + Intronic
1146634935 17:34496859-34496881 GTGTGTGCGTGCGCGCACCCAGG - Intergenic
1146972048 17:37081338-37081360 GTGTATGCACGCGCGCGTGGGGG + Intergenic
1147139487 17:38453453-38453475 GTGTGTGTGCGCGCGCGCGCTGG + Intronic
1147168671 17:38605947-38605969 GTGTCTGCGCGCGCGCGGGCCGG + Intergenic
1147864956 17:43545977-43545999 GTGTACGCGCGCGCGCGCGGAGG + Intronic
1148563406 17:48619262-48619284 GTGTGTGTGCGCGCGCGCGCAGG + Intronic
1148740364 17:49889508-49889530 GTGTGTGTGAGCGCGCGTGGGGG + Intergenic
1148769102 17:50056682-50056704 GAGTGTGCGAGCGCGGGATGCGG + Intronic
1148859214 17:50595376-50595398 GTGTGTGCGTGCCTGTGCTGAGG + Intronic
1149614583 17:57987823-57987845 GTGTGTGCGTGTGTGTGCTGGGG + Intronic
1150765178 17:67996486-67996508 CTGTGTGCGTTTGCGCGCTGGGG + Intergenic
1151794187 17:76332238-76332260 GAGTGTGCGCGGGGGCCCTGGGG - Intronic
1152191879 17:78893071-78893093 GTGTGTGCACGCGTGTGCAGGGG + Intronic
1152549128 17:81020679-81020701 GTGTGTGCTCGCGGGCACTCAGG + Intergenic
1153688630 18:7568728-7568750 GTGCCTGCACGCGCGCGCGGGGG + Intronic
1153923166 18:9809050-9809072 GTGTGTGCGCGCGCACGCGTGGG + Intronic
1154954287 18:21240562-21240584 GTGTGTGCGCGCGCGCGCGCGGG - Intergenic
1156000353 18:32378052-32378074 GTGTGTGCGCGCGGGCGCTTTGG + Intronic
1156099776 18:33578854-33578876 GTGTGTGCGTGCGCGCGCGGAGG + Intronic
1156099778 18:33578856-33578878 GTGTGCGTGCGCGCGCGGAGGGG + Intronic
1157263888 18:46200084-46200106 GTGTGTGTGCGCGCGCGTGCTGG + Intronic
1157263890 18:46200086-46200108 GTGTGTGCGCGCGCGTGCTGGGG + Intronic
1159241646 18:65750581-65750603 GTGTGTGTGTGCGCGCGTGGCGG + Intronic
1159366510 18:67472653-67472675 GTGTGTGTGTGCACACGCTGGGG + Intergenic
1159982147 18:74795939-74795961 GTGTGTGCGCGTGTGCACAGCGG - Intronic
1160334602 18:78027481-78027503 GTGTGTGCGTGCGTGCGCCTGGG - Intergenic
1160509265 18:79444207-79444229 GTGTGTGTGTGCACGCTCTGGGG + Intronic
1160962648 19:1730380-1730402 GTGTGTGTGCGTGCGCGCGTTGG - Intergenic
1160968055 19:1755203-1755225 GTGTGAGCGCGCGCCTGTTGGGG + Intronic
1161264778 19:3359276-3359298 GTGTGTGTGCGCGCGCGCCGCGG + Intergenic
1161643068 19:5436358-5436380 GTGTGCGCGCGCGCGCGTGCGGG + Intergenic
1162584514 19:11550920-11550942 GTGTGCACGCGCGCGCGCATTGG - Intergenic
1163390762 19:17028421-17028443 GTGTGTGCGTGCACGCGCGCAGG + Intergenic
1163390764 19:17028423-17028445 GTGTGCGTGCACGCGCGCAGGGG + Intergenic
1163635772 19:18436710-18436732 GGTTGTCCGCGCGCGCGCTCTGG + Exonic
1163804126 19:19385918-19385940 GGGTGCGCGTGCGCGCGCCGGGG - Exonic
1165390161 19:35534182-35534204 GTGTGTGTGTGCGCGCGCGCGGG - Intronic
1165579701 19:36851322-36851344 GTGTGTGTGTGCGCGCGCGTTGG + Exonic
1166017953 19:39997329-39997351 GTGTGTGTGTGCGCGCGACGGGG + Intronic
1166126019 19:40715863-40715885 GTGTGTGTGCGCGCGCGCGTTGG + Intronic
1166139676 19:40799337-40799359 GGGTGTGGGGGCGCGCGCCGGGG + Intronic
1166780787 19:45341575-45341597 GTGTGCGCGCGCGCGTGTGGTGG + Intronic
1168227246 19:55004593-55004615 GTGTGTGTGTGTGCGCGTTGGGG - Intergenic
1168309369 19:55452770-55452792 GGGCGTGCGCGCGCCGGCTGGGG + Intergenic
1168336527 19:55600362-55600384 GCGAGTGTGCGCGCGCGCGGGGG - Intronic
925532254 2:4877115-4877137 GTGTGTGCGCGCGCGCGCCTGGG - Intergenic
926020182 2:9487834-9487856 GCGCGCGCGCGCGCGCGCTGTGG + Intronic
926206527 2:10837916-10837938 GTGTGTGTGCGCGCGCACGCAGG + Intronic
926435795 2:12836256-12836278 GTGTGTGCGCACACGCGCTGAGG + Intergenic
927000871 2:18792940-18792962 GTGTGCACGCGCGCGCAGTGGGG - Intergenic
927000873 2:18792942-18792964 GTGTGTGCACGCGCGCGCAGTGG - Intergenic
927235518 2:20870908-20870930 GTGTGTGCGCGCGCGCATTCAGG + Intergenic
927256349 2:21043841-21043863 GTGAGTGCGCGGCCGCTCTGCGG - Intronic
929313280 2:40450364-40450386 GTGTGTGCACGCGCGCGCGCTGG + Intronic
929667815 2:43846975-43846997 GTGTGTGCACGCGCGCGTGCAGG - Intronic
931978875 2:67673057-67673079 GTGTGTGTGTGTGTGCGCTGTGG - Intergenic
932329448 2:70889362-70889384 GGGGGTGCGAGCGCGGGCTGGGG - Intergenic
932588816 2:73050381-73050403 GTGTGTGTGTGCGTGCGCTGTGG - Intronic
933817235 2:86077796-86077818 GTGTGTGCGCGCGCGCGTGCAGG - Intronic
935066026 2:99648870-99648892 GTGTGTGCGCGCGTGTTTTGAGG - Intronic
937315114 2:120927219-120927241 GTGTGATCGCGCGGGCACTGCGG + Intronic
937851718 2:126642181-126642203 GTGTGTGTGCGTGCGGGGTGCGG - Intergenic
938900482 2:135795030-135795052 GTGTGTGCGCGCGCGCGCGTGGG - Intronic
939534749 2:143413957-143413979 GTGTGTGTGTGCGCGCTCTCTGG + Intronic
941580808 2:167293576-167293598 GTGTGTGCGCGCGCGCGGCTTGG + Intergenic
941580810 2:167293578-167293600 GTGTGCGCGCGCGCGGCTTGGGG + Intergenic
942970680 2:181954297-181954319 GTGTGTGTGTGCGCGCGCGCGGG - Intronic
945033357 2:205684937-205684959 GTGTGCGCGCTCGCGCGCTGGGG - Intronic
945033359 2:205684939-205684961 GTGTGTGCGCGCTCGCGCGCTGG - Intronic
945699440 2:213151853-213151875 GTGTGCGCGCGCGCGCGGGCTGG + Intronic
947625290 2:231614816-231614838 GTGCGTGCGCGCGCGCGCGCGGG - Intergenic
1169118620 20:3082816-3082838 GTGTGAGCACGGGCGCCCTGGGG + Intronic
1169832240 20:9838174-9838196 GTGTGTGCGCGCGCGCCTGGTGG - Intronic
1170960255 20:21019491-21019513 GTGTGTGCGCGCGCGCGGCAGGG - Intergenic
1171237051 20:23535489-23535511 GTGTGTGTGTGCGCGCGCGCGGG - Intergenic
1171963725 20:31514400-31514422 GTGTGCGCGCGTGCGCGGCGCGG + Intergenic
1172064137 20:32207510-32207532 GGGTGTGGGCGACCGCGCTGAGG + Intronic
1172118300 20:32584118-32584140 GTGTGTGCGCGCGCGGAGGGTGG - Intronic
1172118302 20:32584122-32584144 GTGTGTGTGTGCGCGCGCGGAGG - Intronic
1172778510 20:37422153-37422175 GTGTGTGAGTGTGGGCGCTGAGG + Intergenic
1173429589 20:42974458-42974480 GTGTGTGCGCGCGTGCACTGAGG - Intronic
1173807494 20:45935192-45935214 GTGCGCGCGCGCGCGCGCGCTGG + Intronic
1173915960 20:46709277-46709299 TTGTGTGTGTGCGCACGCTGGGG + Intergenic
1174467856 20:50731392-50731414 GTGAGCGCGCGCACGCGCCGCGG + Intergenic
1175417890 20:58813449-58813471 GTGTGTGCGCGCGCGCATGTGGG - Intergenic
1175720451 20:61282961-61282983 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720452 20:61282998-61283020 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720453 20:61283037-61283059 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720454 20:61283076-61283098 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720455 20:61283115-61283137 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720456 20:61283154-61283176 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720457 20:61283193-61283215 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720458 20:61283232-61283254 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720459 20:61283271-61283293 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720460 20:61283310-61283332 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720461 20:61283340-61283362 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175841312 20:62029469-62029491 GTGTGCGCGCGCGCGCACGTGGG - Intronic
1176112998 20:63418984-63419006 GTGTGTGCAGGCCTGCGCTGGGG - Intronic
1176276007 20:64269783-64269805 GTGTGTGGGTGTGCGCGGTGTGG + Intronic
1178021870 21:28417460-28417482 GTGTGTGTGTGCGCGCGCGCAGG + Intergenic
1179569250 21:42268381-42268403 GTGTGTGTGCGCGCGCGCGCTGG + Intronic
1179950827 21:44707992-44708014 GTGTGTGCACGCGCGGGGCGGGG - Intronic
1179950829 21:44707994-44708016 GTGTGTGTGCACGCGCGGGGCGG - Intronic
1181019945 22:20094473-20094495 GTGTGTGCGCTCTCACCCTGGGG - Intronic
1181069257 22:20322341-20322363 GTGTGTGCGCGCGCGCACAATGG - Intergenic
1181401507 22:22652835-22652857 GTGTGTGCGCGCACGTGCACTGG + Intergenic
1181413296 22:22740185-22740207 GCGCGTGCGCGCGCGCTCTTTGG - Intronic
1181574892 22:23787365-23787387 GGGCGCGCGCGCGCGCGCTCGGG + Intronic
1182041635 22:27242811-27242833 GTGTGTGCGCGCGTGCGCGGGGG - Intergenic
1182041637 22:27242813-27242835 GTGTGTGTGCGCGCGTGCGCGGG - Intergenic
1182149508 22:28018291-28018313 GCGTGTGTGCGCGCGCGGGGGGG + Intronic
1182149510 22:28018293-28018315 GTGTGTGCGCGCGCGGGGGGGGG + Intronic
1182603998 22:31489575-31489597 GTGCGTGAGCGCGGGCGCCGGGG - Exonic
1182638759 22:31750199-31750221 TGGAGTGCGCGCGCGCGGTGCGG - Intergenic
1182737661 22:32542646-32542668 GTGTGTGTGCGCGCGCACACAGG + Intronic
1182885271 22:33768423-33768445 GTGTGTGTGAGCGCGCGCGTTGG - Intronic
1184128942 22:42505721-42505743 GTGTGTGCGCGTGCGTGTGGTGG - Intergenic
1184137737 22:42559036-42559058 GTGTGTGCGCGTGCGTGTGGTGG - Intronic
1184400210 22:44269463-44269485 GTGTGTGTGTGCGCGTGTTGTGG - Intronic
1184478209 22:44732658-44732680 GTATGTGCGTGTGCGTGCTGGGG - Intronic
1185079966 22:48704185-48704207 GTGTGTGCGCGTGTGTGTTGAGG - Intronic
1185394047 22:50577950-50577972 ATGGGTGCGCGGGCGCGCTTAGG + Intronic
950105629 3:10386568-10386590 GTGTGTGTGCGCGTGCGCATGGG - Intronic
951329260 3:21345650-21345672 GTGTGTGCGCGTGTGCGCGAAGG + Intergenic
951640599 3:24830439-24830461 GTGTACGTGCGCGCGCGCCGTGG + Intergenic
952316865 3:32238982-32239004 GTGTGCGAGCGGGCGCGCTGCGG - Exonic
953631993 3:44625733-44625755 GTGTGCGCGCGCGCGCGCAAAGG - Intronic
954256661 3:49412060-49412082 GTGAGTGCGCGCGCGTGCGCGGG - Exonic
954505453 3:51067447-51067469 GTGTGTGTGTGCGCGCGCGTTGG + Intronic
955059689 3:55484447-55484469 GTGTGTTGGCGCGCGCGGAGCGG + Intronic
955663260 3:61323981-61324003 GTGTGTGTGTGCGCGCGTTGGGG + Intergenic
957031901 3:75251688-75251710 GTGTGTGCGCACGCACGTGGAGG + Intergenic
957792910 3:84961632-84961654 GTGTGTGCGCGCGCGCGCGCCGG + Intronic
958166143 3:89880290-89880312 GTGTGTGTGTGCGTGTGCTGTGG + Intergenic
960047441 3:113211695-113211717 GTGTCTGTGCGCGCGCGCGGCGG - Exonic
960790230 3:121422089-121422111 GTGTGTGTGCGTGCGTGCTAAGG - Exonic
963228743 3:142888925-142888947 GTGTGCCGGCGCGCGCGCCGTGG - Exonic
963741863 3:149088725-149088747 GTGTGTGTGTGCGCGCGCGCGGG - Intergenic
966255635 3:177914060-177914082 GTGTGTGTGTGCGCGCGCATGGG - Intergenic
966593005 3:181702018-181702040 GTGTGCGCGCGCGCGCATGGGGG - Intergenic
966593007 3:181702020-181702042 GTGTGTGCGCGCGCGCGCATGGG - Intergenic
967118498 3:186362332-186362354 GTGTGTGTACGCGCGCGCGCCGG - Intergenic
967858504 3:194135024-194135046 GTGTGTGTGCGCGCGCCCCGGGG - Intergenic
967969000 3:194985498-194985520 GTCTCTGCGCGCTGGCGCTGGGG - Intergenic
967987458 3:195106412-195106434 GTGTGTGCGGGGCCGTGCTGGGG - Intronic
968495697 4:914261-914283 GTGTGTGGCCGTGCACGCTGGGG - Intronic
968495756 4:914519-914541 GTGTGTGGCCGTGCACGCTGGGG - Intronic
969344870 4:6564045-6564067 GGGTGTGGGTGCGGGCGCTGGGG + Intergenic
969533819 4:7743791-7743813 GTGTGTGCGCGCGCGCGTGAGGG - Intergenic
970826545 4:20283105-20283127 GTGTGTGCGCGCGCGCACACAGG - Intronic
971809569 4:31406810-31406832 GTGTGTGTCCGCGCGCGTTGGGG - Intergenic
973635876 4:52861959-52861981 GCGAGTGCGCGCGTGGGCTGTGG + Intergenic
975485860 4:74933580-74933602 GTTTGTGCGGGCGCGGGCTGCGG - Intronic
976897466 4:90128515-90128537 GTGCGCGCGCGCGCGCGCTCTGG + Intronic
978084897 4:104639461-104639483 GTGTGTGTGTGTGCGCGCTCAGG - Intergenic
978384967 4:108169151-108169173 GTGTGTGCGCGCGCGCCTGGAGG + Intergenic
978619338 4:110622972-110622994 GGGTGTGCGTGTGCGCGTTGCGG - Exonic
983577002 4:169270994-169271016 GTGTGTGTGCGCGCGTGAGGGGG - Exonic
983672166 4:170250617-170250639 GTGTGTGCGCGTGCGAGCTGTGG + Intergenic
985565851 5:616824-616846 GTGTGTGTGCGCGCGAGTGGGGG + Intronic
985671997 5:1211410-1211432 GTGTTTGCGCTCCCGGGCTGGGG - Intronic
985963944 5:3325250-3325272 GTGTGAGCGCGCGCGTGCGTGGG + Intergenic
986976028 5:13395018-13395040 GTGTGCACGCGCGCGCGCACTGG - Intergenic
986976034 5:13395105-13395127 GTGTGCGCGCGCGCGTGCACTGG - Intergenic
987901085 5:24013042-24013064 GTGTGTGTGCGCGCGCGCGCAGG + Intronic
987901086 5:24013048-24013070 GTGCGCGCGCGCGCAGGCTGTGG + Intronic
988853935 5:35208166-35208188 GTGTGTGTGTGCGCGCGCGTGGG - Intronic
990662745 5:58036006-58036028 GTGTGTGTGCGCACGCACTATGG - Intergenic
991335752 5:65545313-65545335 GTGTGTGTGTGCGCGCTTTGAGG - Intronic
993519454 5:88883219-88883241 GCGTGTGTGCGCGCGCGCGAGGG + Intronic
994959795 5:106584584-106584606 GTGTGTGTGTGCGCGCGCATGGG + Intergenic
995250157 5:109983944-109983966 GTGTGTGCGCACGCGCACAGTGG - Intergenic
997237158 5:132279342-132279364 GTGCGCGCGCGCGCGCGCGTGGG - Intronic
997459874 5:134044655-134044677 GTGTGTGTGCGCGCGCGCACAGG + Intergenic
998143248 5:139711409-139711431 GTGTGTGCGCGCGCGCTCCGAGG + Intergenic
1000665419 5:163989211-163989233 GTGTGTGTGCGCGCGCGTGTGGG + Intergenic
1000665421 5:163989213-163989235 GTGTGTGCGCGCGCGTGTGGGGG + Intergenic
1001245729 5:170104852-170104874 GTGTGTGCGCGTGCGTGCGTGGG + Intergenic
1002058834 5:176614168-176614190 GTGTGTGTGCGCGCGCGCAGGGG - Intergenic
1002058836 5:176614170-176614192 GTGTGTGTGTGCGCGCGCGCAGG - Intergenic
1002257118 5:177966174-177966196 GTTTGTGCGCGTGGGCGGTGGGG + Intergenic
1002515252 5:179753225-179753247 GCGCGCGCGCGCGCGTGCTGGGG + Intronic
1002559739 5:180072914-180072936 GTGTGCGCGCGCGCGCGTTTCGG - Intergenic
1002852931 6:1012361-1012383 GTGTGTGTGTGCGCGCGCGTAGG + Intergenic
1003030766 6:2598748-2598770 GTGTGTGTGTGCGCGCGCTGGGG + Intergenic
1003035487 6:2637533-2637555 GTGTGTGTGTGCGCGTGCGGGGG + Intergenic
1004193626 6:13486208-13486230 GGTTGTGCGCGCGCGCGCCTGGG - Intronic
1004849214 6:19679527-19679549 GTGTGTGCGCGCGCATGTGGTGG + Intergenic
1005942621 6:30571924-30571946 GTGTGTGTATGCGCGCGCAGGGG - Intronic
1006137242 6:31902397-31902419 ACGGGTGCGCGCGCGCGCTGCGG - Intronic
1006271987 6:32972082-32972104 GAGCGAGCGCGCGCGCGCGGAGG + Exonic
1006814333 6:36840120-36840142 GTGTGTGTGTGCGCGCGTGGCGG + Intergenic
1007264663 6:40587446-40587468 GCGTATGCGCGCGCGCGTGGGGG - Exonic
1007702067 6:43771374-43771396 GTGCGTGCGAGCGCGCGCGTGGG + Intronic
1007800451 6:44387916-44387938 GCTTGTGCGCACGCGCGCGGAGG + Intronic
1007885788 6:45228582-45228604 GTGTGTGTGTGCGCGCGCGCGGG - Intronic
1011074987 6:83429914-83429936 GTGTGTGTGTGCGTGCGCTTTGG - Intronic
1012515945 6:100059382-100059404 GTGCGTGCGCGCACGCACTGAGG + Intergenic
1012872897 6:104693053-104693075 GTGTGCACGCGCGCGCGCGCTGG + Intergenic
1012872899 6:104693055-104693077 GTGCACGCGCGCGCGCGCTGGGG + Intergenic
1013272859 6:108559598-108559620 GGGTGTCCGGGCGCGCGCCGTGG - Intergenic
1013575726 6:111482666-111482688 GCGTGTGCGCGTGTGCGCGGCGG + Intronic
1014109283 6:117602370-117602392 GAGTGTGCCCGCGCGCGCGGGGG - Intronic
1014632353 6:123803243-123803265 GTGTGTGCGCGCGCGCTCGGGGG - Intergenic
1014632355 6:123803245-123803267 GTGTGTGTGCGCGCGCGCTCGGG - Intergenic
1016308015 6:142703481-142703503 GTGCGTGCGCGCGCATGTTGCGG - Intergenic
1017164516 6:151394778-151394800 GTGTGTGTGTGCGCGCGCTTAGG + Intergenic
1017175081 6:151494720-151494742 GTGTGTGTGCGCGCGCGCATTGG - Intronic
1018154441 6:160972777-160972799 GTGCGTGCGCGTGCGCGCAATGG - Intergenic
1018329956 6:162716755-162716777 GTGTGCGTGCGCGCGCGCGCAGG - Intronic
1019817554 7:3212205-3212227 GTGTGTGTGTGCGCACCCTGGGG - Intergenic
1021107625 7:16656540-16656562 GTGTGTGCGCGCGCGCGCTGGGG - Intronic
1021107627 7:16656542-16656564 GTGTGTGTGCGCGCGCGCGCTGG - Intronic
1021949840 7:25763970-25763992 GTGTGTGCGCGCGTGCATTTGGG + Intergenic
1022230750 7:28410064-28410086 GCGGGTGGGCGCGCGCGCAGGGG + Intronic
1023064919 7:36367392-36367414 CTGTGCCCGCGAGCGCGCTGGGG + Intronic
1023319419 7:38976616-38976638 GTGTGTGTGCGCGCGCGCTTCGG + Intergenic
1023447680 7:40248869-40248891 GTGCGAGCGCGCGCGCGCGCTGG - Intronic
1026665604 7:72337393-72337415 GTGTGAGTGCGCGCGCGCCGAGG - Intronic
1028964412 7:96786318-96786340 GTGTGTGCGCGCGCACACACAGG + Intergenic
1029449595 7:100633393-100633415 GTGAGTGCGCGCGCGGGCGGGGG - Intronic
1029457095 7:100676808-100676830 GTGTGCGCGGGCTGGCGCTGTGG + Intronic
1029496324 7:100896987-100897009 GCGTGCGTGCGCGCGCGCGGCGG + Intergenic
1031877662 7:127160522-127160544 GTGTGTGTGCGCGCGCGTGATGG - Intronic
1032013411 7:128360970-128360992 GTGTGCGCGCGCGCGTGCAGGGG - Intronic
1032013413 7:128360972-128360994 GTGTGTGCGCGCGCGCGTGCAGG - Intronic
1033725734 7:144115839-144115861 GTGTGTGCGCGCACACGCATGGG - Intergenic
1034147328 7:148884468-148884490 GCGCGTGCGCGCGCGGGCGGCGG + Intergenic
1034824626 7:154250403-154250425 GCGTGTGGGTGCGTGCGCTGGGG + Intronic
1035212801 7:157340988-157341010 GTGTGTGTGTGCGCGCGCGCAGG + Intronic
1037839069 8:22231448-22231470 GTGTGTGCGCGCTCGCGAGTTGG - Intronic
1037878411 8:22560871-22560893 GTGCGCGCGCGCACGCGCCGTGG + Intronic
1038644714 8:29351930-29351952 GTTTGTGCACGCACGCGGTGGGG + Intergenic
1038767909 8:30446841-30446863 GTGCGCGCGCGCGCGCGCGGTGG + Intronic
1039903126 8:41767182-41767204 GGGTGCGGGTGCGCGCGCTGGGG - Intronic
1044488667 8:92785610-92785632 GTGTGTGTGCGCGCGTGCATAGG - Intergenic
1044661813 8:94598873-94598895 GTGTGTGTGCGCGTGCGCGCGGG + Intergenic
1045287780 8:100806878-100806900 GTGTGTGCGCGCGCACGCACAGG + Intergenic
1045538648 8:103059869-103059891 GTGTGTGTGTGTGCGTGCTGGGG - Intronic
1046094345 8:109539853-109539875 TTGTGTGCGCGCGCGGCCCGCGG + Intronic
1046209406 8:111048004-111048026 GTGTGTGTGCGTGCGCACTGGGG + Intergenic
1047113847 8:121818852-121818874 GTGAGTGGGCGCAGGCGCTGGGG - Intergenic
1047274662 8:123396473-123396495 GATTCTGGGCGCGCGCGCTGCGG - Intronic
1047423565 8:124727079-124727101 GTGTGCGCGCGCGCGCGTGGGGG - Intronic
1047423567 8:124727081-124727103 GTGTGTGCGCGCGCGCGCGTGGG - Intronic
1047969529 8:130072813-130072835 GTGTGTGTGTGTGCGCGCGGGGG + Intronic
1047969531 8:130072815-130072837 GTGTGTGTGTGCGCGCGGGGGGG + Intronic
1047969533 8:130072817-130072839 GTGTGTGTGCGCGCGGGGGGGGG + Intronic
1048484255 8:134832340-134832362 GTGTGTGTGCGCGCGCGCGTGGG + Intergenic
1049342872 8:142123053-142123075 GTGTGTGCGCACATGGGCTGTGG - Intergenic
1049744079 8:144255758-144255780 GCGTGTGCACGCGCGTGGTGGGG + Intronic
1050091283 9:2017556-2017578 GTGTGTGCGCGCGCGAGCGGCGG + Intronic
1050771851 9:9211500-9211522 GTGTGTGCGTGCGCACACTGGGG - Intronic
1055397632 9:75891512-75891534 GTGCGTACGCGCGCGCGCGCAGG - Intronic
1056341589 9:85639350-85639372 GTGTGCGCGTGCGCGCGCATGGG - Intronic
1056652054 9:88473651-88473673 GTGTGTGTGTGCACGCGCTATGG + Intronic
1056910895 9:90699514-90699536 GTGTGTGTGTGCGCGCGGCGGGG - Intergenic
1056910897 9:90699516-90699538 GTGTGTGTGTGTGCGCGCGGCGG - Intergenic
1059269328 9:113062085-113062107 GTGTGCGCGCCCGCGTGCTTGGG + Intergenic
1059270464 9:113067530-113067552 GTGTGCGCGCGCGCGCGTGCTGG + Intergenic
1059270466 9:113067532-113067554 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059271601 9:113072980-113073002 GTGTGCGCGCGCGCGCGTGCTGG + Intergenic
1059271603 9:113072982-113073004 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059272732 9:113078424-113078446 GTGTGCGCGCGCGCGCGTGCTGG + Intergenic
1059272734 9:113078426-113078448 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059273866 9:113083866-113083888 GTGTGCGCGCGCGCGCGTGCTGG + Intergenic
1059273868 9:113083868-113083890 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059274999 9:113089310-113089332 GTGTGCGCGCGCGCGCGTGCTGG + Intergenic
1059275001 9:113089312-113089334 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1060051756 9:120383151-120383173 GTGTGTGCGCGCCCTGGCGGCGG - Intergenic
1060225705 9:121788999-121789021 GTGTGTGCGCACGCGCGTGCAGG - Intergenic
1060463867 9:123884982-123885004 GTGTGTGCGCGCGCGCTCGCAGG - Intronic
1060826854 9:126692637-126692659 GTGTGTGCGTGCATACGCTGTGG + Intronic
1062119923 9:134828983-134829005 GTGTGTGCGCGTGCATGGTGTGG - Intronic
1185723143 X:2397919-2397941 GTGTGTGTGTGCGCGCTCTGAGG - Intronic
1185881587 X:3745954-3745976 GTGTGTGTGCACGCGCGCATGGG - Intergenic
1186209982 X:7240450-7240472 GTGTGTGCGCGCGCGCTCCTTGG - Intronic
1186490594 X:9969422-9969444 GTGTGTGCGCGCGTGCACTGGGG - Intergenic
1186490596 X:9969424-9969446 GTGTGTGTGCGCGCGTGCACTGG - Intergenic
1187487990 X:19722548-19722570 GTGTGTGTGCGCGTGCGCACTGG + Intronic
1188095865 X:26020644-26020666 GTGTGTGCGCGCGCGTGCATGGG - Intergenic
1188597812 X:31922522-31922544 GTGTGCGCGCGCGTGCGCTAGGG + Intronic
1188825491 X:34827948-34827970 GTGTGTGTGTGTGTGCGCTGAGG - Intergenic
1189197054 X:39161790-39161812 GTGTCTGCGTGCACACGCTGAGG + Intergenic
1189322889 X:40097150-40097172 GTGGGCGGGCGGGCGCGCTGAGG - Intronic
1194035534 X:88866236-88866258 GTGTGTGTGCGCGCGCGCAAAGG + Intergenic
1194035536 X:88866238-88866260 GTGTGTGCGCGCGCGCAAAGGGG + Intergenic
1195668472 X:107450311-107450333 TTGTGTGCGCGCCTGGGCTGTGG + Intergenic
1195922580 X:109998333-109998355 GTGTGTGCGTGCACGTGCTTGGG + Intergenic
1197559848 X:128006303-128006325 GTGTGTGCACGCGCACGCGTGGG - Intergenic
1197655139 X:129108644-129108666 GTGTGTGTGCGCGCGCGCGGCGG + Intergenic
1197655141 X:129108646-129108668 GTGTGTGCGCGCGCGCGGCGGGG + Intergenic
1197782490 X:130171890-130171912 GTGTGCGCGCGCGCGCGTGAAGG - Exonic
1198115493 X:133540946-133540968 GTGTGTGTGTGCGCGCACTGTGG + Intronic
1198115495 X:133540948-133540970 GTGTGTGTGCGCGCACTGTGGGG + Intronic
1198441506 X:136667841-136667863 GTGCGTGCACGTGCGCGCTTGGG - Exonic
1198808472 X:140511037-140511059 GGGAAAGCGCGCGCGCGCTGGGG - Intergenic