ID: 1021109812

View in Genome Browser
Species Human (GRCh38)
Location 7:16680717-16680739
Sequence GGATCACTTGAGCACCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021109807_1021109812 5 Left 1021109807 7:16680689-16680711 CCTAGCTACTTGGGAGGCTGAGG 0: 92836
1: 203589
2: 246027
3: 262461
4: 302975
Right 1021109812 7:16680717-16680739 GGATCACTTGAGCACCCTGGAGG No data
1021109805_1021109812 13 Left 1021109805 7:16680681-16680703 CCTGTGGTCCTAGCTACTTGGGA 0: 362
1: 7533
2: 60813
3: 176590
4: 231523
Right 1021109812 7:16680717-16680739 GGATCACTTGAGCACCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021109812 Original CRISPR GGATCACTTGAGCACCCTGG AGG Intronic
No off target data available for this crispr