ID: 1021110212

View in Genome Browser
Species Human (GRCh38)
Location 7:16685252-16685274
Sequence GATTCTCTTGCCCCAGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 586
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 562}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021110212 Original CRISPR GATTCTCTTGCCCCAGAGGC AGG (reversed) Intronic
901068011 1:6503825-6503847 GAGCCGCCTGCCCCAGAGGCAGG + Intronic
901561045 1:10071019-10071041 GATTCTCCTGCCTCAGTAGCTGG + Intronic
903110529 1:21129207-21129229 GATTCTCTTGCCTCAGTCTCTGG - Intronic
903882033 1:26517108-26517130 GATCCTCTTGGCCAGGAGGCAGG + Intergenic
906230139 1:44155518-44155540 GATTCTCTTGCCTCAGCCTCTGG - Intergenic
906309334 1:44741962-44741984 CATTCTGTTGCCCAGGAGGCTGG - Intronic
907043732 1:51286396-51286418 GATTCTCCTGCCCAAGTAGCTGG + Intergenic
907569578 1:55470616-55470638 GATTCTCTTGCCTCAGCCTCTGG + Intergenic
908188349 1:61674453-61674475 GATTCTCTTGCCTCAGCCCCTGG + Intergenic
908542752 1:65137245-65137267 GATTCTCCTGCCTCAGTGTCAGG + Intergenic
908543776 1:65146157-65146179 GATTCTCTTGCCTCAGCCTCTGG + Intergenic
908645969 1:66278278-66278300 GTTTCTCTGGCCCCATAAGCAGG - Intronic
908911551 1:69077789-69077811 CATTCCCATTCCCCAGAGGCTGG + Intergenic
909343716 1:74560891-74560913 GATTCTCTTGCCTCAGCCTCCGG - Intergenic
909608375 1:77529437-77529459 GATTCTCCTGCCTCAGCAGCGGG + Intronic
910125493 1:83837525-83837547 GCTTCACTTGTCCCAGAGGCAGG + Intergenic
910433889 1:87185704-87185726 GATTCTCCTGCCTCAGACTCTGG + Intergenic
911186746 1:94911958-94911980 GATTCTCCTGCCTCAGTAGCTGG - Intronic
911611073 1:99959711-99959733 AATTCTCTTGGCCCCGAGGAAGG - Intergenic
912147874 1:106816778-106816800 CATTCTCTTGCCCCAGCCTCCGG + Intergenic
915110130 1:153558971-153558993 GATTCTCTTGCCTGAGTAGCTGG - Intergenic
915222109 1:154383273-154383295 GATTCTCTTGCCTCAGCCTCCGG - Intergenic
915337177 1:155151575-155151597 GATTCTCTTGCCTCAGCCTCTGG - Intergenic
915456512 1:156044148-156044170 GATTCTCAGTCCGCAGAGGCTGG + Exonic
915476068 1:156153656-156153678 GGTTCCCAGGCCCCAGAGGCAGG - Exonic
917963623 1:180165256-180165278 GAAGCTCATGCCCCAGGGGCAGG - Intronic
918197402 1:182235054-182235076 GTTTCTCTGGCACCAAAGGCGGG - Intergenic
921016232 1:211194060-211194082 GATTCTCCTGCCTCAGACTCTGG + Intergenic
921717254 1:218430287-218430309 GATTCTCTCGCCTCAGACTCCGG - Intronic
922874423 1:228928765-228928787 GATTCTAGAACCCCAGAGGCAGG - Intergenic
923700810 1:236298742-236298764 GATTCTCCTGCCCCAGCCTCCGG + Intergenic
923704281 1:236331389-236331411 GATTCTCTTGCCTCAGCCTCCGG + Intergenic
923788084 1:237087209-237087231 TATTCTCCTGGCCCAGATGCTGG - Intronic
924621389 1:245664251-245664273 GATTCTCCTGCCTCAGTTGCTGG - Intronic
924916677 1:248576955-248576977 GATTCTCTTGTCCTAGAAGGGGG - Intergenic
1063369046 10:5508970-5508992 GTTTCTGCTGGCCCAGAGGCTGG + Intergenic
1063452335 10:6158759-6158781 GATTCTCTTGCCTCAGTCTCTGG - Intronic
1063594822 10:7424688-7424710 GATACTCTTGCTCAAGATGCTGG + Intergenic
1064335566 10:14437559-14437581 GATTCTCCTGCCTCAGTGGCTGG + Intronic
1065535734 10:26713184-26713206 GATTCTCTTGCCCCAGCCTCCGG - Intronic
1065576700 10:27128035-27128057 GATTCTCTTGCCACAGAATTTGG - Intronic
1067061875 10:43081837-43081859 GATTCTTTGTCCCCTGAGGCAGG + Intronic
1067109843 10:43392431-43392453 GATTCTCCTGTCCCAGCGTCTGG - Intronic
1068375313 10:56170542-56170564 GATTCTCCTGCCTCAGCGTCTGG + Intergenic
1068992650 10:63165638-63165660 GATTCTCCTGCCTCAGACTCCGG - Intergenic
1069466183 10:68641306-68641328 GATTCTCCTGCCTGAGAGGCAGG + Intronic
1069542766 10:69307942-69307964 GATTCTCCTGCCCCAGCCTCTGG + Intronic
1070183652 10:74039015-74039037 GATTCTCTTGCCTCAGCCTCCGG + Intronic
1070305537 10:75236916-75236938 GATTCTCCTGCCTCAGACTCTGG + Intergenic
1070354959 10:75631053-75631075 TCTTCTCCTGCCCCAGAGCCAGG + Intronic
1071492491 10:86145326-86145348 GATTCTCTTGCCTCAGCCTCCGG + Intronic
1071544621 10:86520187-86520209 GATTCTCCTGCCCCAGCCTCCGG - Intronic
1071770337 10:88722187-88722209 GATTCTCTTGCCCCAGCCCCCGG - Intergenic
1072194732 10:93107415-93107437 GATCCTCATGCCCCATTGGCAGG + Intergenic
1072242659 10:93511706-93511728 GATTCTCTTGCCTCAGCGTCCGG + Intronic
1072256283 10:93624351-93624373 GATTCTCATGCCTCAGTAGCTGG + Intronic
1072581698 10:96745440-96745462 GATTCTCTTGCCTCAGCCTCCGG - Intergenic
1073034718 10:100555566-100555588 GATCCTCTTGCCTCAGACCCTGG + Exonic
1073251773 10:102124467-102124489 GATTCTCTTGCCTCAGCCTCCGG + Intergenic
1073373355 10:103010716-103010738 GATTCTCCTGCCTCAGCGTCCGG + Intronic
1073844890 10:107544263-107544285 GTTTCTCTTGCTCCCCAGGCTGG + Intergenic
1074846778 10:117405693-117405715 GATTCTCTTGCCTCAGCCTCTGG - Intergenic
1075140819 10:119833561-119833583 GATCCTCTTGCCTCAGTAGCTGG - Intronic
1075144304 10:119870339-119870361 GATTCTCCTGCCCCAGCCTCCGG - Intronic
1077578248 11:3400515-3400537 GATTCTCCTGCCTCAGCGTCCGG - Intergenic
1078782367 11:14451421-14451443 GATTCTCTTGCCTCAGCCTCTGG - Intronic
1080533875 11:33203123-33203145 GATTCTCTTGCCTCAGCCTCTGG + Intergenic
1080863999 11:36177487-36177509 GATTCTTTTGTCCCACAGGGTGG + Intronic
1081049003 11:38314590-38314612 GATTCTCCTGCCTCAGCGTCCGG - Intergenic
1081484313 11:43516109-43516131 GACTGTCTTGCTCCAGAAGCTGG + Intergenic
1081502783 11:43682434-43682456 GATTCTCTTGCCTCAGCCTCTGG - Intronic
1082250442 11:49973495-49973517 GATTCTCTTGCCTCAGCCTCTGG - Intergenic
1082276813 11:50231060-50231082 GATTCTCCTGCCTCAGACTCTGG - Intergenic
1082831417 11:57621113-57621135 GATTCTCTTGCCTCAGCCTCCGG - Intergenic
1083441647 11:62680471-62680493 GATTCTCCTGCCCGAGTAGCTGG + Intergenic
1083906683 11:65676560-65676582 GATTCTCGTGCCTCAGACTCTGG - Intergenic
1084017051 11:66390378-66390400 GATTCTCCTGCCTCAGTAGCTGG + Intergenic
1084075597 11:66773173-66773195 GATCCTCTTGCCTCAGATTCAGG + Intronic
1084314841 11:68339451-68339473 GATTCTCTTGCCTCAGCCTCCGG + Intronic
1085015631 11:73172270-73172292 GATTCTCTTGCCTCAGCCTCCGG - Intergenic
1086300537 11:85422594-85422616 GATTCTCTTGCCTCAGCCTCTGG + Intronic
1086460993 11:87005187-87005209 CATTCTCTTGCCTCAGACTCCGG - Intergenic
1086945235 11:92838195-92838217 AATTCTCTTTCCCCAGTGGCAGG + Intronic
1087002037 11:93430988-93431010 GATTCTCTTGCCTCAGCTTCTGG - Intronic
1088372542 11:109107252-109107274 GATTCTCTTGCCTCAGCCTCCGG + Intergenic
1088544920 11:110949742-110949764 GTTTCTCTGGCTCCAGAGCCTGG + Intergenic
1089431185 11:118425786-118425808 GATTCTCCTGCCTCAGACTCCGG - Intronic
1089694291 11:120207308-120207330 GATTCTCGTGCCTCAGTCGCCGG + Intergenic
1089696655 11:120220040-120220062 GCTGCTCTTGAGCCAGAGGCAGG + Intronic
1090382311 11:126336008-126336030 GATTCTCTTGCCTCAGTAGCTGG - Intronic
1090665516 11:128912614-128912636 GATTCTCCTGCCCCAGCCTCTGG + Intronic
1091362678 11:134990360-134990382 AATTCCCTTGGCCCAGAGGGTGG - Intergenic
1091902788 12:4158175-4158197 GATTCTCCAGCCCCAGTAGCTGG - Intergenic
1093015797 12:14153383-14153405 GGTTCTCTTGCCCCTGCGGTGGG - Intergenic
1093117018 12:15223393-15223415 GATTCTCTTGCCTCAGCCTCTGG - Intronic
1093188391 12:16048241-16048263 GATCCCCTTGGCCCAGATGCGGG - Intergenic
1093450599 12:19308954-19308976 GATTCTCCTGCCTCAGAATCTGG - Intronic
1093863385 12:24195988-24196010 GATTCTCCTGCCTCAGACGCTGG + Intergenic
1096802050 12:54116960-54116982 GATTCTCTTGCCTCAGTCTCCGG + Intergenic
1097218450 12:57432103-57432125 GATTCTCCTGCCTCAGCGTCCGG + Intergenic
1097846047 12:64367911-64367933 GATTCTCCTGCCTCAGACTCCGG + Intronic
1098275910 12:68810969-68810991 GATTCTCTTGCCTCAGCCTCTGG + Intronic
1098561380 12:71876914-71876936 GATTCTCTTGCCTCAGCCTCCGG + Intronic
1099463876 12:82958247-82958269 GATTCTCCTGCCTCAGTAGCTGG - Intronic
1100105580 12:91167943-91167965 GATTCTCCTGCCTCAGTAGCTGG + Intronic
1100725581 12:97405252-97405274 GGTTCTCTTGCCCCAGAATGAGG + Intergenic
1101035567 12:100702543-100702565 GATTCTCTTGCCTCAGTCTCCGG + Intergenic
1101545357 12:105707147-105707169 GACCCTCTTGCCCCAAAGCCAGG + Intergenic
1101781530 12:107843084-107843106 GATTCTCTTGCCTCAGTCTCCGG - Intergenic
1101855505 12:108439573-108439595 GATCCTCTTGGCCAAGAGGGTGG - Intergenic
1102451866 12:113047924-113047946 GATTCTCTTGCCTCAGCCTCCGG + Intergenic
1102758012 12:115359277-115359299 GATTATCTGGCCACAGAGCCTGG - Intergenic
1103220748 12:119242303-119242325 GATTCTCTTGCCTCAGCCTCTGG - Intergenic
1103324608 12:120112080-120112102 GATTCTCTTGCCTCAGCCTCCGG + Intronic
1103654452 12:122459060-122459082 GATTCTCCTGCCCCAGCCTCTGG - Intergenic
1103674026 12:122641640-122641662 GATTCTCTTGCCTCAGCCTCTGG - Intergenic
1104079447 12:125417326-125417348 CATGCTTTTGCCCGAGAGGCAGG + Intronic
1104222879 12:126802864-126802886 GAGTCTGGTGCCACAGAGGCAGG - Intergenic
1105490432 13:20882779-20882801 GATTCTCTTGCCTCAGACTCTGG - Intronic
1106976466 13:35223023-35223045 GATTCTCCTGCCTCAGACTCCGG - Intronic
1107717192 13:43212132-43212154 GATTCTCCTGCCCTAGTAGCTGG + Intergenic
1107723753 13:43276770-43276792 GATTGTCCTTCCCCAGAGACAGG - Intronic
1108340590 13:49495603-49495625 GATTCTCATGCCTCAGTGTCTGG + Intronic
1109429498 13:62212883-62212905 GATTCTCTTGCCTCAGCTTCCGG + Intergenic
1110774834 13:79395637-79395659 GATTCTTTTGCCTCAGTAGCTGG - Intronic
1110860310 13:80340111-80340133 AAGTCTCCTGCCCCCGAGGCGGG + Intronic
1112551944 13:100429710-100429732 GATTCTCTTGCCTCAGCCTCTGG + Intronic
1113510885 13:110853969-110853991 GATTCTCCTGCCTCAGCGTCCGG + Intergenic
1114041253 14:18680741-18680763 GATTCTCCTGCCCCAGCCTCCGG + Intergenic
1114276492 14:21150369-21150391 AATTCTCTTTCCCCTGAGTCTGG - Intergenic
1116617427 14:47156012-47156034 GATTCTCATGCCTCAGCCGCTGG + Intronic
1116850365 14:49902943-49902965 GATTCTCCTGCCTCAGACTCCGG + Intergenic
1117659044 14:57985290-57985312 GATTCTCCTGCCTCAGCCGCCGG - Intergenic
1118648347 14:67863229-67863251 GATTCTCTTGCCTCAGCCTCTGG + Intronic
1118833424 14:69457306-69457328 GATTCTCCTGCCCCAGCTTCCGG + Intronic
1119917220 14:78413389-78413411 GATTCTCCTGCCTCAGCTGCTGG + Intronic
1120305223 14:82761284-82761306 GATTCTCTTGCCTCAGCCTCCGG + Intergenic
1120711504 14:87797904-87797926 CATTCTTTTGCACCAGAGACTGG - Intergenic
1121091201 14:91184014-91184036 GACTCTCATTCCCCAGAGTCAGG + Intronic
1121302101 14:92880237-92880259 GATTCTCCTGCCCGAGTAGCTGG + Intergenic
1121344303 14:93123982-93124004 GATTCTCCTGCCTCAGACTCTGG + Intergenic
1122599744 14:102915362-102915384 GCTCCTCTTGACCCGGAGGCCGG + Intergenic
1124176472 15:27429580-27429602 CATTCTCTTTCCCCAGATCCTGG + Intronic
1124432126 15:29616952-29616974 GATTCTCTTGCCTCAGCCTCCGG - Intergenic
1124586952 15:31018769-31018791 GATTCTCGTGCCTCAGTAGCTGG + Intronic
1125022132 15:34996267-34996289 GATTCTCTTGCCTCAGCCTCCGG + Intergenic
1125631266 15:41149101-41149123 GATTCTCTTGCCTCAGCCTCTGG + Intergenic
1125644664 15:41261884-41261906 GATTCTCCTGCCCCAGCCTCTGG - Intronic
1125700823 15:41682021-41682043 GATTCTCTTGCCTCAGCCTCCGG + Intronic
1125936746 15:43643441-43643463 GATTCTCTTGCCTCAGCCTCCGG + Intronic
1126432445 15:48600596-48600618 GATTCTCTTGCCTCAGCCTCCGG - Intronic
1126858627 15:52862489-52862511 GATTCCCTTGCAACAGAGGGAGG + Intergenic
1127629967 15:60819093-60819115 TAATCTCATGCCCCAGAGGGAGG - Intronic
1128004382 15:64225253-64225275 TATTCTCCTGCCTCAGAGGCAGG - Intronic
1128691205 15:69726190-69726212 GATTCTAGTTCCTCAGAGGCGGG - Intergenic
1128764868 15:70245038-70245060 GATTCTCCTGCCTCAGTGTCTGG - Intergenic
1129474319 15:75774731-75774753 GATTCTCCTGCCCCAGCGCTGGG + Intergenic
1129984672 15:79907604-79907626 GAGTCTCCTGCCTCAGAGTCTGG - Intronic
1130129406 15:81125973-81125995 GATTCTCTTGCCTCAGCCTCTGG + Intronic
1131122923 15:89834219-89834241 GGTTCTCATGCTCCAGAAGCTGG + Exonic
1131281522 15:91025146-91025168 GATTCTCCTGCCTCAGACTCTGG + Intergenic
1131931604 15:97448885-97448907 GATAATCTTCCCCCAGAGTCTGG - Intergenic
1132403274 15:101526978-101527000 AAATCTCTGGCCCCAGAGGGAGG + Intergenic
1132534163 16:468890-468912 GAGGGTCTTGCCCCAGAGGGCGG - Intronic
1132893752 16:2217654-2217676 GGTCCTCTAGCCCCAGATGCAGG - Intergenic
1132986821 16:2771649-2771671 GAATCTCTTGTCCCTGAGGCTGG + Intronic
1133215197 16:4288135-4288157 AATTCTCCTGCCCCAGATGGGGG + Intergenic
1133490213 16:6260773-6260795 GATTCTCTTGCCTCAGCCCCTGG - Intronic
1133658654 16:7892526-7892548 GATTCTCTTGCCTCAGCCTCTGG + Intergenic
1134176996 16:12015344-12015366 GATTCTCCTGCCTCAGCGTCCGG + Intronic
1134658459 16:15965700-15965722 GATTCTCCTGCCTCAGCCGCTGG + Intronic
1134867821 16:17624299-17624321 GATTCTCTTGCCTCAGCCCCCGG - Intergenic
1135276046 16:21113562-21113584 GATTCTCTTGCCTCAGCCTCTGG + Intronic
1135736687 16:24937314-24937336 GATTCTCCTGCCTCAGCCGCCGG - Intronic
1135736784 16:24938256-24938278 GATTCTCTTGCCTCAGCCTCCGG - Intronic
1136148071 16:28327585-28327607 GATTCTCTTGTCCCAGCCTCCGG - Intergenic
1136189952 16:28609650-28609672 GATTCTCTTGCCTCAGCCTCTGG - Intronic
1136445637 16:30316174-30316196 GATTCTCTTGCCTCAGCCTCCGG - Intergenic
1136533341 16:30884307-30884329 GACTCTCCTGTCCCTGAGGCTGG - Intronic
1137262226 16:46841080-46841102 GATTCTCTTGCCTCAGCCTCTGG + Intergenic
1139561513 16:67745438-67745460 GATTCTCTTGCCTCAGCCTCTGG + Intronic
1139746543 16:69079222-69079244 GATTCTCTTGCCTCAGCCTCCGG - Intronic
1139958932 16:70706615-70706637 GATTCTCTTGCCTTGGTGGCTGG + Intronic
1140782369 16:78308295-78308317 AATCCCCTTGGCCCAGAGGCAGG - Intronic
1140854021 16:78961649-78961671 GATTCTCTTGCACGTGAAGCTGG - Intronic
1141209664 16:81965535-81965557 GATTCTCCTGCCTCAGCGTCCGG - Intergenic
1141284999 16:82663290-82663312 GATTCTCTTGCCTCAGCCTCTGG + Intronic
1142832130 17:2557082-2557104 GATTCTCTTGCCCAAAGTGCTGG - Intergenic
1143315674 17:6031482-6031504 GATTCTCGTGCCTCAGCGTCTGG - Intronic
1143543149 17:7581378-7581400 GTTTCTCCTGCCCCAGTGACCGG + Exonic
1143873459 17:9974437-9974459 ATTTTTCTTCCCCCAGAGGCTGG - Intronic
1144084712 17:11798325-11798347 GATTCTCTTGCCTCAGCCTCTGG - Intronic
1144878075 17:18412706-18412728 GATTCTCCTGCCTCAGGCGCTGG - Intergenic
1145154155 17:20531719-20531741 GATTCTCCTGCCTCAGGCGCTGG + Intergenic
1145355807 17:22148610-22148632 CTTTCCCTTGCCCCAGAGTCCGG - Intergenic
1145749629 17:27346078-27346100 GATTCTCTTGCCTCAGCCTCAGG + Intergenic
1145754969 17:27383661-27383683 GATTCTCCTGCCTCAGACTCCGG + Intergenic
1145974458 17:28976266-28976288 GATTCTGGTACCCCTGAGGCTGG + Intronic
1146041894 17:29463463-29463485 GATTCTCTTGCCTCAGCCCCCGG - Intronic
1146408889 17:32565107-32565129 GATTCTCTTGCCTCAGCTTCTGG + Intronic
1147261390 17:39211388-39211410 GATTCTCTTGCCTCAGCCTCTGG + Exonic
1147267360 17:39242936-39242958 GATTCTCTTGCCTCAGCCTCTGG - Intergenic
1147848581 17:43423349-43423371 GATTCTCATGCCTCAGTAGCTGG + Intergenic
1148104130 17:45110336-45110358 GATTCTCTTGCCTCAGCCTCCGG - Exonic
1148711843 17:49687618-49687640 GGCTCTGTTGCCCCAGTGGCAGG - Intergenic
1149768717 17:59302511-59302533 GATTCTCTTGCCTCAGCCACTGG - Intergenic
1149917519 17:60624678-60624700 GATTCTCTTGCCTCAGCCTCCGG - Intronic
1150131731 17:62672884-62672906 GATTCTCTTGCCTCAGCCTCTGG - Intronic
1150142496 17:62742123-62742145 GATTCTCTTGCCTCAGCCTCCGG + Intronic
1150212436 17:63448460-63448482 GATTCTCTTGCCTCAGCCTCCGG - Intergenic
1150271383 17:63867764-63867786 GATTCTCGTGCCTCAGTAGCTGG + Intergenic
1150472770 17:65451185-65451207 TATTCCTTTGTCCCAGAGGCAGG - Intergenic
1150612216 17:66742743-66742765 GATTATATCGCCCCAGAGGTAGG + Exonic
1150698279 17:67424799-67424821 GATTCTCTTGCCTCAGTGTCAGG + Intronic
1150995689 17:70314996-70315018 GATTCTCTTGCCTCAGCCTCTGG + Intergenic
1151951801 17:77358531-77358553 GATTCTCGTGCCTCAGTAGCTGG - Intronic
1152207403 17:78981537-78981559 GAATCTTTAGCCCCAGAGTCCGG + Intergenic
1152217584 17:79042727-79042749 GACTCTCCTTCCCGAGAGGCTGG + Intronic
1152516173 17:80826144-80826166 GGTTTTCTTGCCCCAGCTGCTGG - Intronic
1152521039 17:80857176-80857198 GACTCTCTGCCCTCAGAGGCAGG - Intronic
1153053972 18:927570-927592 AATTCTTTTGCCCCAAAGGGAGG + Intergenic
1153484709 18:5585407-5585429 AATTCTCCTGCCCCAGACTCCGG + Intronic
1153926327 18:9838471-9838493 GATTCCCTTCCCTCACAGGCAGG + Intronic
1153926863 18:9842245-9842267 AAATCTCCAGCCCCAGAGGCTGG + Intronic
1154428612 18:14291337-14291359 AATTCTCTTGGCCCAGAAGAAGG + Intergenic
1155129623 18:22919655-22919677 GATTCTCCTGCCTCAGACTCTGG + Intronic
1155490951 18:26401412-26401434 GATTCTCCTGCCTCAGACTCTGG + Intergenic
1155577387 18:27263149-27263171 AATGCTCTTGCCCCAGTGGTAGG + Intergenic
1156471052 18:37377491-37377513 AATGCTCTGGCCCCAGATGCAGG + Intronic
1157055368 18:44222170-44222192 GATTCTCCTGCCTCAGAGCAGGG + Intergenic
1158021561 18:52848189-52848211 GATTCTCCTGCCCCAGCCTCCGG + Intronic
1158273155 18:55738318-55738340 AAGTTTCTGGCCCCAGAGGCAGG - Intergenic
1158631693 18:59120856-59120878 GATGCTCTTACCCCAGAGCATGG + Intergenic
1158977517 18:62725252-62725274 GATTCTCCTGCCCCAGCCTCTGG - Intronic
1159500775 18:69266271-69266293 GATTCTCCTGCCTCAGTGTCTGG - Intergenic
1159841697 18:73405910-73405932 GATTCTCTTGCCTCAGCCTCTGG + Intergenic
1160334480 18:78026462-78026484 GATTCTCATGCTCCTGAGGGTGG - Intergenic
1161526491 19:4759355-4759377 GCTTCTTATGCCCCAGAAGCAGG - Intergenic
1162040683 19:7969124-7969146 GATTCTCTTGCCTCAGCCTCTGG - Intronic
1162042688 19:7980069-7980091 GATTCCCCTGCCCCAGAGAAAGG - Intronic
1162133211 19:8539994-8540016 GATGCTCTTCCCCGAGAAGCTGG - Exonic
1162277909 19:9672883-9672905 GATTCTCTTGCCTCAGCCTCCGG + Intronic
1162408613 19:10491111-10491133 GATTCTCCTGCCTCAGACCCTGG - Intronic
1162812559 19:13173017-13173039 GATTCTCTTGCCTCAGCCTCTGG + Intergenic
1162995308 19:14331152-14331174 GATTCTCTTGCCTCAGCCTCTGG + Intergenic
1163335704 19:16670378-16670400 GATTCTCCTGCCTCAGCTGCCGG + Intronic
1163908215 19:20166449-20166471 GATTCTCTTGCCTCAGCCTCCGG + Intergenic
1163927223 19:20357163-20357185 GATTCTCCTGCCCCAGCCTCCGG - Intergenic
1164497088 19:28776201-28776223 GATTCTCCTGCCCCAGCCTCCGG - Intergenic
1164626562 19:29732606-29732628 GATTCTCTTGCCTCAGCCTCCGG + Intergenic
1165187725 19:34036397-34036419 GGTGTTCTTGCCCCAGAGGTTGG + Intergenic
1166081893 19:40448970-40448992 GATTCTCCTGCCCAAGTAGCTGG - Intronic
1166111072 19:40623278-40623300 GATTCTCTTGCCTCAGCCTCTGG + Intronic
1166229230 19:41416047-41416069 GATTCTCCTGCCTCAGACTCCGG + Intronic
1166538632 19:43591740-43591762 GATTCTCCTGCCTCAGCGTCCGG - Exonic
1166884213 19:45949844-45949866 GATTCTCCTGCCTCAGCCGCTGG + Intronic
1166979562 19:46624558-46624580 GATTCTCCTGCCCCAGCCTCTGG + Intronic
1167075803 19:47248304-47248326 GATTCTCTTGCCTCAGCCCCCGG + Intergenic
1167242058 19:48350104-48350126 GATTCTCCTGCCTCAGACTCCGG + Intronic
1167688193 19:50969330-50969352 CATCTGCTTGCCCCAGAGGCCGG - Intronic
1167901760 19:52627545-52627567 GATTCTCCTGCCTCAGTAGCTGG - Intronic
925356620 2:3246563-3246585 GATTGTCTTCCCCCAGAAACTGG + Intronic
926360029 2:12078255-12078277 GATTCTATTGGCCCAGTGGCAGG + Intergenic
928037124 2:27835168-27835190 GATTCTCCTGCCCCAGCCTCTGG - Intronic
928259149 2:29750962-29750984 GATTCTCCTGCCTCAGCCGCTGG - Intronic
929175294 2:38969497-38969519 GGTTCTCTTCCCTCTGAGGCTGG + Intronic
929629241 2:43442328-43442350 GATTCTCTTGCCTCAGCTTCTGG - Intronic
929683307 2:44012682-44012704 GATTCTCTTGCCTCAGCCTCCGG + Intergenic
930025229 2:47025469-47025491 GCCTGGCTTGCCCCAGAGGCAGG - Intronic
930113973 2:47702915-47702937 GATTCTCCTGCCTCAGTAGCTGG - Intronic
930177085 2:48312765-48312787 GATTCTCATGCCCCAGCGTCCGG - Intergenic
931473491 2:62564217-62564239 GATTCTCCTGCCTCAGTAGCTGG - Intergenic
932360903 2:71104749-71104771 GATTCTCTTGCTTCAGTAGCTGG - Intergenic
932770838 2:74499940-74499962 CCTTCTCTGGCCCCAGCGGCTGG + Intronic
933562865 2:83910987-83911009 GATTATCTGGGCCCAGAGGTGGG - Intergenic
933595096 2:84275340-84275362 CATTCTCTTTCTCCAGATGCGGG - Intergenic
933979724 2:87539821-87539843 GATTCTCTGGCCTCCGAGACTGG + Intergenic
934068611 2:88363322-88363344 GATTCTCCTGCCTCAGACTCTGG + Intergenic
935253889 2:101290955-101290977 GATTCTCTTTCCCAGGATGCTGG + Intronic
935512992 2:103999533-103999555 GATTCTCTTGCCTCAGCCTCTGG + Intergenic
936314097 2:111410970-111410992 GATTCTCTGGCCTCCGAGACTGG - Intergenic
936437211 2:112518778-112518800 GATTCTCCTGCCTCAGCGTCTGG + Intronic
936487232 2:112936536-112936558 GATTCTCTTGCCTCAGCCTCCGG + Intergenic
936509554 2:113134088-113134110 GTCTTTCTTACCCCAGAGGCTGG + Intergenic
937102663 2:119283578-119283600 GATTCTCCTGCCCCAGCCTCTGG + Intergenic
937938747 2:127268362-127268384 GATTCTCTTGCCTCAGCCTCCGG + Intronic
938085731 2:128400329-128400351 GATTCTCCTGCCTCAGCTGCTGG + Intergenic
938098529 2:128479433-128479455 GTTTCTCCTGCTCCAGTGGCAGG + Intergenic
938382020 2:130841952-130841974 GATGCTCTTCCCCCAGGGTCGGG + Intronic
938787773 2:134648172-134648194 GATAATCTTCCCCCAGAGTCTGG + Intronic
938887712 2:135670022-135670044 GCTTCTCTTGCCCAAGGAGCTGG - Intronic
940376217 2:152962196-152962218 GATTCTCCTGCCTCAGTAGCTGG + Intergenic
940719323 2:157264529-157264551 TATTCTCTTAGCCCAGAGCCAGG + Intronic
941394484 2:164957233-164957255 GATTCTCTTGCCTCAGCCTCAGG + Intergenic
942563848 2:177247553-177247575 GATTCTCTTGCCTCAGCCTCTGG - Intronic
942955040 2:181763913-181763935 GATTCTCCTGCCTCAGCGTCCGG + Intergenic
942980724 2:182078072-182078094 GATTCTCCTGCCTCAGACTCCGG - Intronic
943007760 2:182407485-182407507 GATTCTCTTGCCTCAGTCTCTGG + Intronic
943718631 2:191179629-191179651 GATTCTCCTGCCACAGATTCCGG + Intergenic
943900723 2:193432488-193432510 GATTCTCCTGCCTCAGACTCCGG + Intergenic
944555437 2:200883726-200883748 GGCTATCTTGCCCCAGAGTCTGG - Intronic
944775305 2:202957838-202957860 GATTCTCCTGCCTCAGCAGCTGG - Intronic
948224068 2:236295102-236295124 GATTCTCTTGCCTCAGCCTCCGG + Intergenic
948890750 2:240905923-240905945 GATTCCTTTGCCCCTCAGGCAGG + Intergenic
1171794658 20:29557504-29557526 GATTCTCTTGCCTCAGTCTCCGG - Intergenic
1171820145 20:29828537-29828559 AATTCTCTTGGCCCCGAGGAAGG + Intergenic
1171822435 20:29865668-29865690 AATTCTCTTGGCCCCGAGGAAGG + Intergenic
1171853795 20:30326761-30326783 GATTCTCTTGCCTCAGTCTCCGG + Intergenic
1171897688 20:30824621-30824643 AATTCTCTTGGCCCTGAGGAAGG - Intergenic
1172271686 20:33658810-33658832 CATCCTCATGGCCCAGAGGCAGG - Exonic
1172552093 20:35809137-35809159 AATTCTCTTGCCTCAGACTCAGG - Intronic
1172746253 20:37211533-37211555 GATTCTCTTGCCTCAGCCTCCGG - Intronic
1172934674 20:38611320-38611342 GATTCTCTTGGCCAAGAGAGTGG + Intronic
1173070966 20:39764808-39764830 GATTCTCTTGCCTCAGCCTCTGG + Intergenic
1173509635 20:43616401-43616423 GATTCTCTTGCCTCAGTCTCTGG - Intronic
1173596280 20:44260615-44260637 GCTTCTGTGGCCCCGGAGGCTGG - Intronic
1173912454 20:46680471-46680493 GCACCTATTGCCCCAGAGGCAGG + Intronic
1174304545 20:49605751-49605773 GATTCTCCTGCCTCAGTGCCCGG - Intergenic
1174479757 20:50822739-50822761 GATTCTCGTGCCCCAGCAGCTGG + Intronic
1174802121 20:53573227-53573249 GATTCTCTTGCCTCAGCCTCTGG + Intronic
1175095846 20:56541013-56541035 GATTCTCCTGCCTCAGACCCCGG + Intergenic
1175144003 20:56882091-56882113 CATTCTCATGCCCGAGAAGCTGG - Intergenic
1176658590 21:9612886-9612908 GATTCTCTTGTCCCACATGGTGG + Intergenic
1176848888 21:13897628-13897650 AATTCTCTTGGCCCGGAAGCAGG - Intergenic
1178991487 21:37360508-37360530 GATTCTCTTGCCTCAGCCTCCGG + Intergenic
1179232483 21:39517864-39517886 GATTCTCCTGCCTCAGCTGCCGG + Intergenic
1179390671 21:40987407-40987429 GATTCTCTTGCCTCAGCCTCCGG - Intergenic
1179486658 21:41714879-41714901 AATTCTCTTGGCCCCGAGGAAGG - Intergenic
1179729013 21:43357076-43357098 GATTCTCCTGCCTCAGACTCTGG + Intergenic
1180324143 22:11353225-11353247 AATTCTCTTGGCCCCGAGGAAGG + Intergenic
1180648334 22:17358322-17358344 GATTCTCCTGCCTCAGACTCCGG + Intergenic
1181416677 22:22764621-22764643 GATTCTCTGGCCCCAACAGCAGG + Intronic
1181562427 22:23713705-23713727 GATTCTCCTGCCTCAGCAGCTGG + Intergenic
1181576066 22:23795894-23795916 GATTCTCTTGCCTCAGCCTCTGG + Intronic
1181810011 22:25398276-25398298 GATTCTCATGCCTCAGCAGCTGG - Intronic
1182172770 22:28249668-28249690 GCTTCACTTCCCCCTGAGGCAGG + Intronic
1183630730 22:39031058-39031080 GATTCTCTTGCCTCAGCCTCCGG - Intronic
1183864744 22:40695217-40695239 GATTCTCTTGCCTCAGGTTCTGG + Intergenic
1183926857 22:41212501-41212523 GATTCTCCTGCCCCAGCCTCCGG + Intronic
1184346795 22:43918531-43918553 AATTCTCTTCCCCCAGAACCAGG + Intergenic
1184360033 22:44010995-44011017 CATTCTCCTGCCTCAGAGACAGG + Intronic
1185261967 22:49871858-49871880 GATTCTCCTGCCTCAGTAGCTGG + Intronic
949327246 3:2880595-2880617 AGTTCTCTTGCCCCTGAGTCTGG - Intronic
949711583 3:6876705-6876727 GATTCTCTTGCCTCAGCCACTGG + Intronic
950039451 3:9910577-9910599 GATTCTCATGCCTCAGTAGCTGG - Intronic
951552041 3:23883808-23883830 GATTCTCTTGCCTCAGCCTCTGG - Intronic
951903333 3:27679079-27679101 GATTCTCTTGCCTCAGCCTCTGG + Intergenic
952793534 3:37218774-37218796 GATTCTCCTGCCTCAGTAGCTGG - Intergenic
953897831 3:46815852-46815874 GATTCTCCTGCCCCAGCCTCCGG - Intergenic
954097633 3:48341851-48341873 GATTCTCCTGCCCCAGACTCTGG - Intergenic
954965569 3:54607425-54607447 GATTCTCCTGCCGATGAGGCCGG + Intronic
955019557 3:55106075-55106097 GATTTTCTTGTCCCAGAGAGCGG + Intergenic
955103228 3:55872232-55872254 GTTTCTCTTCCTCCAAAGGCAGG - Intronic
955219551 3:57012362-57012384 GATTCTCTTGCCTCAGCCTCCGG + Intronic
959179150 3:102956336-102956358 GATTCTCTTGCCTCAGCCTCCGG + Intergenic
961679922 3:128592727-128592749 GATTCTCTTGCCTCAGACTCTGG - Intergenic
961691938 3:128676310-128676332 AATTCTCTTGGCCCCGAGGAAGG - Intronic
962782123 3:138729173-138729195 GATTCTCATGCCTCAGTGTCCGG - Intronic
963198032 3:142555128-142555150 GATTCTCCTGCCCCAGCCTCCGG - Intronic
963732440 3:148986691-148986713 GATTCTCAGTCCGCAGAGGCTGG + Intergenic
964116113 3:153138044-153138066 GATTCTCCTGCCTCAGTAGCTGG + Intergenic
964325071 3:155536144-155536166 GATTCTTTTGTCCCACAGGGTGG - Intronic
964352928 3:155820710-155820732 GATTCTCCTGCCCCAGCCTCCGG - Intergenic
964421597 3:156509728-156509750 GAGTCTCCTTTCCCAGAGGCAGG + Intronic
965280673 3:166748039-166748061 GATTCTCCTGCCTCAGTAGCTGG + Intergenic
965487132 3:169292226-169292248 GATTCTCTGGCCCGAGTAGCTGG - Intronic
965518580 3:169649301-169649323 GATTCTCTTGCCTCAGCCTCTGG - Intronic
966822422 3:183935607-183935629 GATTCTCTTGCCTCAGCCTCTGG + Intronic
967105169 3:186249725-186249747 GATTCTCCTGCCTCAGAAGTTGG - Intronic
967180315 3:186897585-186897607 AATTCTCTTGGCCCCGAGGAAGG - Intergenic
968244283 3:197126359-197126381 CATTCTCTTGCCTCAGTAGCTGG - Intronic
968637326 4:1687425-1687447 GATTCTCTTGCCTCAGCCTCTGG - Intergenic
968994035 4:3934205-3934227 GATTCTCCTGCCTCAGACTCCGG - Intergenic
971061754 4:22979179-22979201 GATTCTTTTGTCCCACAGGGTGG - Intergenic
971309594 4:25513980-25514002 GATTCTCTTGCCTCAGCCTCTGG + Intergenic
971340848 4:25767177-25767199 GATTCTCCTGCCCGAGTAGCTGG - Intronic
973336875 4:48965582-48965604 AATGCTCTTGGCCCAGAGGATGG - Intergenic
973752824 4:54040593-54040615 GATTCTCTTGCCTCAGCCTCCGG - Intronic
974788698 4:66657050-66657072 GATTCTCCTGCCTCAGCCGCAGG - Intergenic
975146325 4:70971388-70971410 GATTCTCCTGCCTGAGTGGCTGG - Intronic
976887940 4:90008371-90008393 GATTCTTTTGTCCCACAGGGTGG - Intergenic
977207196 4:94176809-94176831 GATTCTCTTGCCTCAGCCTCTGG - Intergenic
977637205 4:99313130-99313152 GATTCTCTTGCCTCAGCCTCCGG + Intronic
980120575 4:128723894-128723916 GATTCTCCTGCCCCAGCATCCGG - Intergenic
980729952 4:136812165-136812187 ATTTCTCCTGCCCCAGAAGCCGG - Intergenic
981644833 4:146986950-146986972 GCTTCTCTAGCCCTAGAGCCAGG + Intergenic
982593835 4:157352612-157352634 GATTCTCCTGCCTCAGTGTCCGG - Intronic
983074332 4:163307053-163307075 GATTCTCCTGCCTCAGCGTCAGG + Intergenic
983095945 4:163562189-163562211 GATTCTCCTGCCCCAGCCTCTGG - Intronic
983778849 4:171643003-171643025 GGTCCTCTTGCCCAAGAGGGAGG - Intergenic
984319668 4:178177406-178177428 GATTCTCATGCCTCAGTAGCTGG + Intergenic
984594593 4:181653513-181653535 GATTCTCCTGCCTCAGTAGCTGG + Intergenic
985883744 5:2659965-2659987 GATTCTCTTGCCTCAGCCTCTGG + Intergenic
987139526 5:14931124-14931146 GATTCTCTTGCCTCAGCCTCTGG + Intergenic
988736915 5:34031727-34031749 GATTCTCTTGCCTCAGCCTCTGG - Intronic
989020216 5:36996602-36996624 AATTCTCTTGCTCCAGAAGAAGG - Intronic
989605513 5:43240647-43240669 GATTCTCCTGCCTCAGTAGCTGG + Intronic
990169226 5:53029164-53029186 GATTCTCCTGCCTCAGACTCTGG - Intronic
992121518 5:73598229-73598251 GATTCTCCTGCCTCAGACTCTGG - Intergenic
992778490 5:80107983-80108005 GATTCTGTTGCCCCTGTGGTTGG - Intergenic
993229307 5:85211551-85211573 GATTCTCTTGCCTCAGCCTCTGG + Intergenic
994131628 5:96235727-96235749 AATTTTCTTCCCCCAGAGGGAGG - Intergenic
994204857 5:97023357-97023379 GATTCTCCTGCCCCAGTATCCGG + Intronic
996714072 5:126572452-126572474 GATTCTCATGCCTTAGGGGCAGG - Intronic
997166755 5:131668577-131668599 GATTCTCTTGCCTCAGCCTCTGG - Intronic
997277230 5:132605148-132605170 GATTCTCTTGCCTCAGCCTCTGG + Intronic
997412567 5:133701295-133701317 GATTCTCCTGCCCCAGCCACTGG - Intergenic
997866053 5:137463840-137463862 GATTCTCTTGCCTCAGTCTCCGG - Intronic
997975834 5:138440785-138440807 TTTTCTCTAGCCCCGGAGGCAGG - Intronic
998196083 5:140072973-140072995 GATTCTCCTGCCTCAGCCGCTGG - Intergenic
998451866 5:142240956-142240978 GATTCTCTTGCCTCAGCCTCTGG + Intergenic
998835723 5:146201448-146201470 GATTCTCCTGCCTCAGTGTCTGG + Intergenic
999137848 5:149334801-149334823 GATTCTCTTGCCTCAGCCTCCGG - Intronic
999725612 5:154434927-154434949 GAGTCTCTTGTCACTGAGGCTGG - Intergenic
1000054172 5:157589525-157589547 GATTCTCTTGCCTCAGCCTCCGG + Intergenic
1000312208 5:160056000-160056022 GCTTCCCTTGCCCCAGGTGCTGG + Intronic
1000422891 5:161058206-161058228 GATTCTGTGGTCCAAGAGGCAGG + Intergenic
1000427219 5:161105891-161105913 GATTGTCCTGACCCAGAGGAGGG + Intergenic
1000811974 5:165874430-165874452 GATTCTCCTGCCTCAGACTCCGG - Intergenic
1000899408 5:166894743-166894765 GATTCTCTTGCCTCAGCCTCCGG + Intergenic
1001084582 5:168691503-168691525 GAGCTTCTGGCCCCAGAGGCTGG + Intronic
1001098855 5:168797350-168797372 AAATCTCTTGCCACAGTGGCAGG - Intronic
1001196699 5:169679406-169679428 GACTCTCATGGCCCAGGGGCAGG - Intronic
1001207161 5:169775012-169775034 GATTCTCTTGCCTCAGCCCCCGG + Intronic
1001397629 5:171428434-171428456 GACCCTCTTGCCCCAGAGTCTGG - Intronic
1001409871 5:171503420-171503442 GATTCTCCTGCCTCAGTAGCTGG - Intergenic
1001825226 5:174739485-174739507 GAATCTCTTGACCCAGGAGCAGG - Intergenic
1002153809 5:177258938-177258960 GATTCTCTTGCCTCAGCCCCTGG + Intronic
1002758333 6:182213-182235 GATTCTCTTGCCTCAGCCTCCGG - Intergenic
1003546359 6:7062729-7062751 GATGCTCTTGAGCCAGAGGAGGG + Intergenic
1003935550 6:10971787-10971809 GATTCTCCTGCCTAAGAGGCTGG + Intronic
1004387678 6:15186690-15186712 GATTCTCCTGCCTCAGCTGCTGG + Intergenic
1005089416 6:22041259-22041281 GATTCTCCTGCCTCAGTAGCTGG - Intergenic
1007028111 6:38598809-38598831 GATTCTCTTGCCTCAGCCTCCGG - Intronic
1007135717 6:39519914-39519936 GATTCTCTTGCCTCAGCCTCCGG - Intronic
1007532554 6:42555722-42555744 TATTCTCCTGCCTCAGAGGCAGG - Intergenic
1008610076 6:53177621-53177643 GATTCTCTTGCCTCAGCCTCTGG + Intergenic
1010381200 6:75226983-75227005 GATTCTCATGCCTCAGCAGCTGG + Intergenic
1010824081 6:80451621-80451643 GATTCTCATGCCTCAGTAGCTGG - Intergenic
1012554114 6:100491123-100491145 GATTCTCTTGCCTCAGCCTCCGG + Intergenic
1013088955 6:106882031-106882053 GATTCTCCTGCCTCAGACTCTGG - Intergenic
1014954851 6:127602074-127602096 GATTCTCTGGACCAACAGGCTGG + Intergenic
1015507648 6:134006064-134006086 GATTCTCTTGCCTCAGCCTCTGG - Intronic
1015510914 6:134037458-134037480 GATTCTCCTGCCTCAGCGTCCGG + Intronic
1016979117 6:149838021-149838043 GATTCTCTTGCCTCAGCCTCTGG + Intronic
1017005584 6:150026142-150026164 GATTCTCTTGCCTCAGCTTCTGG + Intergenic
1017485438 6:154897900-154897922 GATTTTCTTGCCCCAAATCCTGG + Intronic
1017683330 6:156886296-156886318 GATTCTCTTGCCTCAGCCTCTGG + Intronic
1018311821 6:162517351-162517373 CATTCTCTTGCCTCAGCCGCCGG + Intronic
1018956881 6:168416187-168416209 GGTGCTCTTGCCACAGATGCAGG + Intergenic
1019466957 7:1195134-1195156 GATTCTCGTGCCGCAGTAGCTGG - Intergenic
1019827130 7:3293649-3293671 GATTCTCCTGCCCCAGCCTCTGG + Intergenic
1020078853 7:5275728-5275750 GACACTCTTGGCCCAGAGCCTGG + Intronic
1020291903 7:6729119-6729141 GATTCTCTTGCCTCAGCCTCCGG + Intergenic
1020835020 7:13138464-13138486 GCTTTTCTTACGCCAGAGGCTGG - Intergenic
1021110212 7:16685252-16685274 GATTCTCTTGCCCCAGAGGCAGG - Intronic
1021444933 7:20722714-20722736 GATTCTCTTGCCTCAGCCTCTGG - Intronic
1024259987 7:47566925-47566947 GATTCTCCTGCCTCAGTAGCTGG - Intronic
1025230387 7:57200312-57200334 GATTCTCCTGCCTCAGCAGCTGG + Intergenic
1025617848 7:63139576-63139598 GATTCTCTTGCCTCAGCCTCCGG + Intergenic
1025730587 7:64103404-64103426 GATTCTCCTGCCTCAGCAGCTGG - Intronic
1025795165 7:64732789-64732811 GATTCTCCTGCCTCAGCGTCTGG + Intergenic
1025928688 7:65978881-65978903 GATTCTCCTGCCTCAGCAGCTGG + Intronic
1026591442 7:71699368-71699390 GATTCTCCTGCCTCAGACTCCGG - Intronic
1026805209 7:73424967-73424989 GATTCTCCTGCCTCAGACTCCGG - Intergenic
1026857365 7:73763549-73763571 GATTCTCTTGCCTCAGCCTCTGG + Intergenic
1027261316 7:76466702-76466724 GATTCTCCTGCCTCAGACTCCGG + Intronic
1027312700 7:76964811-76964833 GATTCTCCTGCCTCAGACTCTGG + Intergenic
1027419323 7:78004442-78004464 GAGTCTCTTATCCAAGAGGCTGG + Intergenic
1029471389 7:100756872-100756894 GATTCTCCTGCCTCAGACTCCGG + Intronic
1029881129 7:103811213-103811235 GCTTCTATTGCCCCACAAGCAGG - Intronic
1029982545 7:104892603-104892625 GATTCTCTTGCCTCAGCCTCTGG - Intronic
1030608127 7:111660293-111660315 GATTCTCCTGCCTCAGCGTCTGG + Intergenic
1030634482 7:111933398-111933420 GATTCTCCTGCCTCAGACTCCGG + Intronic
1030682634 7:112450014-112450036 GCTTCTCTTTCTCCGGAGGCTGG - Intronic
1031683465 7:124703531-124703553 GATTCTCTTGCCTCAGCCTCTGG + Intergenic
1032146099 7:129382492-129382514 GATTCTCATGCCTCAGACTCCGG - Intronic
1032389604 7:131547265-131547287 GATTCTCCTGCCCCAGCCTCTGG - Intronic
1032802701 7:135329366-135329388 AAGCCTCTTGCCCCAGAGGGCGG - Intergenic
1034119085 7:148610926-148610948 TGTTCTGTGGCCCCAGAGGCTGG + Intronic
1034181911 7:149146049-149146071 GATTCTCTTGCCTCAGCCTCCGG + Intronic
1034604283 7:152296326-152296348 GATTCTCTTGCCTCAGCCTCTGG - Intronic
1035423207 7:158746944-158746966 GATTCTCTTGCCTCAGCCTCCGG - Intronic
1035490925 7:159277646-159277668 TAATCTCTTGCCCCAGACACCGG + Intergenic
1036772551 8:11589032-11589054 GATTCTCTTGCCTCAGCCTCCGG - Intergenic
1036837360 8:12084694-12084716 GATTCTCTTGCCTCAGCCACCGG - Intergenic
1036859153 8:12330938-12330960 GATTCTCTTGCCTCAGCCACCGG - Intergenic
1037105165 8:15097639-15097661 GATTCTCTCGCCTCAGTAGCTGG - Intronic
1037196000 8:16190825-16190847 GATTCTCCTGCCTCAGACTCCGG + Intronic
1038113724 8:24529286-24529308 CATTCTATGGCCTCAGAGGCAGG + Intergenic
1038229487 8:25686966-25686988 GAATGTCTTGCTCCAGAGGGAGG + Intergenic
1038373407 8:27014270-27014292 AGATCTCTTGCCTCAGAGGCTGG - Intergenic
1039862686 8:41472329-41472351 GATTCTCCTGCCTCAGACTCCGG - Intergenic
1039910376 8:41821942-41821964 GATTCTCTTGCCTCAGCCTCCGG - Intronic
1039981598 8:42413329-42413351 GATTCTCCTGCCTCAGACTCCGG + Intergenic
1040108113 8:43551420-43551442 AATTCTCTTGGCCCCGAGGAAGG + Intergenic
1040109498 8:43560803-43560825 AATTCTCTTGGCCCTGAGGAAGG + Intergenic
1040456128 8:47599870-47599892 GATTCTCGTGCCCAAGTAGCTGG + Intronic
1040661503 8:49581610-49581632 GATTCTCTTGCCTCAGCCTCTGG - Intergenic
1041091540 8:54306048-54306070 GATTCTCCTGCCCCAGCCTCCGG + Intergenic
1041145744 8:54874536-54874558 GATTCTCTTGCCCCTTAGAAAGG - Intergenic
1041185028 8:55290233-55290255 GATTCTCTTGCCTCAGCCTCCGG + Intronic
1041278136 8:56184809-56184831 GATTCTCTTGCCTCAGCCTCTGG - Intronic
1042435317 8:68757513-68757535 GATTCACCTGCCTCAGAAGCTGG - Intronic
1042971049 8:74409455-74409477 GATTCTCCTGCCCCAGCCTCCGG + Intronic
1043199654 8:77350757-77350779 GATTCTCTTGCCTCAGCCTCTGG + Intergenic
1046295530 8:112215038-112215060 GATTCTCCTGCCTCAGACTCTGG + Intergenic
1046753266 8:117946810-117946832 GTTTCACTTTCCCCAGAGGAAGG - Intronic
1048560109 8:135526658-135526680 TTCTCTCTTGCCCCAGAAGCTGG - Intronic
1049067869 8:140333018-140333040 GATTCTCTTGCCTCAGTCTCTGG - Intronic
1049964206 9:763682-763704 GATTCTCCTGCCTCAGATTCCGG - Intergenic
1050330424 9:4540214-4540236 GATAATCTTCCCCCAGAGTCTGG - Intronic
1052813007 9:33077707-33077729 GATTCTCTTGCCTCAGCCTCCGG + Intergenic
1052844562 9:33323645-33323667 GATTCTCCTGCCTCAGCCGCCGG - Intronic
1052927922 9:34032816-34032838 GATTCTCGTGCCCCAGCCTCTGG - Intronic
1053233311 9:36430310-36430332 GATTCTCCTGCCTCAGACTCCGG + Intronic
1053403032 9:37844728-37844750 GATTCTCCTGCCTCAGTAGCTGG - Intronic
1053791594 9:41690052-41690074 GATTCTCTTGCCTCAGTCTCCGG + Intergenic
1054179998 9:61902067-61902089 GATTCTCTTGCCTCAGTCTCCGG + Intergenic
1054255750 9:62810765-62810787 AATTCTCTTGGCCCCGAGGAAGG - Intergenic
1054335560 9:63804843-63804865 AATTCTCTTGGCCCCGAGGAAGG + Intergenic
1054657595 9:67679074-67679096 GATTCTCTTGCCTCAGTCTCCGG - Intergenic
1054912869 9:70469919-70469941 GATCCTCCTGCCCCAGCTGCTGG + Intergenic
1054979574 9:71189481-71189503 AATTCTTTTGCCCCAAAGACAGG + Intronic
1055096684 9:72421520-72421542 GATTCTCTTGCCTCAGCCTCTGG + Intergenic
1055164279 9:73172493-73172515 GATTCTCTTGCCCCAGCTCCAGG + Intergenic
1055219285 9:73908936-73908958 GATTCTCTTGCCTCAGCCTCTGG + Intergenic
1055461819 9:76526913-76526935 GATTCTCTTGCCTCAGCCTCCGG - Intergenic
1055932242 9:81571530-81571552 GATTCTCCTGCCCGAGTAGCTGG + Intergenic
1056235302 9:84588243-84588265 GATTCTCTTGCCTCAGCCTCCGG + Intergenic
1057133582 9:92671079-92671101 GATTCTCTTGCCTCAGCCTCCGG - Intergenic
1057620122 9:96627288-96627310 GATTCTCTTGCCTCAGCCTCTGG - Intergenic
1057760731 9:97872174-97872196 GATCCTCTTGCCTCAGACTCAGG + Intergenic
1058051821 9:100413811-100413833 GATTCTCCTGCCTCAGCCGCCGG - Intergenic
1059475710 9:114545976-114545998 GATTCTCCTGCCTCAGTAGCTGG + Intergenic
1060533772 9:124366296-124366318 GATTCTCCTGCCTCAGCAGCTGG - Intronic
1060927755 9:127467120-127467142 AATTCTCTTGGCCCTGAGGAAGG + Intronic
1061022134 9:128022789-128022811 GATTCTCTTGCCTCAGCCTCCGG - Intergenic
1061150973 9:128827814-128827836 GATTCTCCTGCCCCAGCCTCCGG - Intronic
1061157335 9:128872021-128872043 GATTCTCCTGCCCCAGCCTCCGG - Intronic
1061516790 9:131094815-131094837 TATTCTCTGGCCCCAGAGGTGGG + Intergenic
1061836827 9:133335063-133335085 GATTCTCTTGCCTCAGCCTCCGG + Intronic
1062210815 9:135362792-135362814 GACTCTCTTCCCCCAAGGGCAGG + Intergenic
1203371804 Un_KI270442v1:313803-313825 AATTCTCTTGGCCCCGAGGAAGG + Intergenic
1203375494 Un_KI270442v1:372293-372315 AATTCTCTTGGCCCCGAGGAAGG + Intergenic
1203636318 Un_KI270750v1:116465-116487 GATTCTCTTGTCCCACATGGTGG + Intergenic
1185535655 X:859817-859839 GATTCTCCTGCCTCAGCGTCCGG + Intergenic
1187011972 X:15288777-15288799 GATTCTCCTGCCCTAGCCGCCGG - Intronic
1188045805 X:25425529-25425551 GATTCTGTTGTCCCACAGGGTGG + Intergenic
1188249112 X:27870326-27870348 GATTCTCCTGCCTCAGCGTCCGG + Intergenic
1188543012 X:31270324-31270346 AAGTCTATTGCCCCAGAGGGTGG - Intronic
1188675640 X:32936215-32936237 GATTCTCCTGCCTCAGACTCCGG + Intronic
1189229685 X:39442593-39442615 GATTCTCTGGGCTCAGATGCTGG - Intergenic
1190361105 X:49649315-49649337 GATTCTCTTGCCTCAGCCTCCGG + Intergenic
1190702908 X:53001379-53001401 GATTCTCATGCCCCAGCCTCCGG + Intergenic
1192811476 X:74550731-74550753 GATTCTCTTGCCTCAGCCTCCGG - Intergenic
1194587114 X:95748887-95748909 GATTCTCCTGCCCCAGCCTCAGG - Intergenic
1194775167 X:97954264-97954286 GATTCTCGTGCCTCAGACACCGG - Intergenic
1195591154 X:106628747-106628769 GATTCTCCTGCCCGAGTAGCTGG + Intronic
1195620928 X:106954015-106954037 GATTCTCTTGCCTCAGCCTCTGG - Intronic
1196257160 X:113534234-113534256 GATTCTCCTGCCCCAGCCTCCGG - Intergenic
1196606097 X:117658699-117658721 GATTCTCTTGCCTCAGCCTCCGG - Intergenic
1196670081 X:118356947-118356969 GATTCTCTTGCCTCAGCCTCCGG + Intronic
1196951745 X:120931520-120931542 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196952429 X:120936381-120936403 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196953114 X:120941242-120941264 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196953799 X:120946102-120946124 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196954484 X:120950963-120950985 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196955167 X:120955823-120955845 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196955854 X:120960706-120960728 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196956536 X:120965567-120965589 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196957218 X:120970427-120970449 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196957900 X:120975287-120975309 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196958582 X:120980147-120980169 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196959263 X:120985007-120985029 GCTGCTGCTGCCCCAGAGGCTGG - Exonic
1196963243 X:121026619-121026641 CCTTCTCCAGCCCCAGAGGCAGG + Intergenic
1197472086 X:126876864-126876886 GATTCTTTTGACCCAGGGGATGG + Intergenic
1197785115 X:130190966-130190988 GATGCTGTAGCCCCAAAGGCAGG - Intergenic
1198018234 X:132633166-132633188 GTTTCTCTTGCACAATAGGCTGG - Intronic
1198360629 X:135892205-135892227 GATTCTCGTGCCTCAGTAGCTGG - Intronic
1199077525 X:143541149-143541171 GATTCTCCTGCCTCAGCTGCTGG - Intergenic
1199107439 X:143887069-143887091 GATTCTCTTGCCTCAGCCCCTGG + Intergenic
1199807318 X:151313161-151313183 GATTCTCTTGCCTCAGCCTCCGG - Intergenic
1199852778 X:151737281-151737303 GTGTCTCTTGCCACAGAGTCAGG - Intergenic
1200791081 Y:7299571-7299593 GATTCTCATGCCTCAGACTCTGG + Intergenic
1201066535 Y:10101310-10101332 AATTCTCTTGGCCCCGAGGAAGG - Intergenic