ID: 1021110308

View in Genome Browser
Species Human (GRCh38)
Location 7:16686414-16686436
Sequence GTTTCTCTAGACCTTGAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 128}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021110308 Original CRISPR GTTTCTCTAGACCTTGAGAG GGG (reversed) Intronic
910088648 1:83435808-83435830 GGGTGTCTAGACCTTGAGAATGG + Intergenic
911123378 1:94318210-94318232 CTTTTTCTAGACCTTGTGTGCGG + Intergenic
915540576 1:156563407-156563429 GTTTGTCTGGCCCTTGAGGGTGG - Intronic
916257287 1:162802126-162802148 ATTTCTCTACAGCTTGAGTGGGG - Intronic
916806177 1:168263853-168263875 GTTTGTTGAGACTTTGAGAGAGG + Intergenic
917479384 1:175398091-175398113 GTTTTGCTGGACCTTGTGAGTGG + Intronic
918267511 1:182858571-182858593 GATGCTCTAAATCTTGAGAGAGG - Exonic
918656743 1:187036153-187036175 GTTTCTCTAGGTCTGGAGAGTGG - Intergenic
919340158 1:196295526-196295548 GTTTCTGTAGACATTTTGAGTGG - Intronic
920045429 1:203129335-203129357 GTTTCTCTGGCCCTGCAGAGCGG - Intronic
920079975 1:203365939-203365961 CTTTCTCTAAACCTTCAGAGAGG + Intergenic
921450517 1:215300510-215300532 TTTTCTCTAATCCTTTAGAGTGG + Intergenic
1063120010 10:3098962-3098984 GTTTCGCTAGAGGTTGAAAGGGG - Intronic
1065220900 10:23495074-23495096 GACTCTGTAGACCTTGGGAGGGG + Intergenic
1066489805 10:35883512-35883534 GTTCCTCGAGACCTTGATAAAGG - Intergenic
1068220300 10:54036028-54036050 CTTTCTCTGGAGCTTGAGAGAGG + Intronic
1072431223 10:95372631-95372653 GTTTAACTAGACCTTGATAGTGG + Intronic
1075071213 10:119320968-119320990 GTTTCTCTGTATCCTGAGAGGGG - Intronic
1075387732 10:122069180-122069202 CTTTCTCCAGACCTTCAGTGGGG + Intronic
1076571788 10:131438071-131438093 GGTTCCCTAGTCCTTCAGAGAGG + Intergenic
1077669855 11:4147212-4147234 GTTTCCCTGGACTTCGAGAGTGG - Intergenic
1077787289 11:5398320-5398342 GGTTCTCTGGATATTGAGAGAGG + Intronic
1078261842 11:9716755-9716777 GTTTATCTACAGCTTGTGAGAGG + Intronic
1083640205 11:64141322-64141344 TTTTCCCTAGACCTCTAGAGTGG - Intronic
1085746482 11:79119208-79119230 ATTTCTCTAGACCTGGATGGAGG - Intronic
1086192729 11:84098486-84098508 CTTTCTCTAGGCGTTTAGAGAGG - Intronic
1090941170 11:131389488-131389510 GCTTCTCTAGACCTGCAGACTGG + Intronic
1091326895 11:134697904-134697926 TTTTCTATGGACCTTGAGGGTGG - Intergenic
1094005618 12:25747163-25747185 GTTTCTCTGAACCTAGAAAGTGG - Intergenic
1097318823 12:58202887-58202909 GTGTTCCTAAACCTTGAGAGAGG + Intergenic
1097975565 12:65682891-65682913 GTCTTCCTAGACCTTGAGACAGG + Intergenic
1099721931 12:86374042-86374064 GATTCTCTAGACTTTGAGATAGG - Intronic
1103390804 12:120571800-120571822 ATTTCTCTTCACTTTGAGAGGGG + Intronic
1104948475 12:132427991-132428013 GTTTCACCAGACCGTGGGAGAGG + Intergenic
1110569124 13:76985681-76985703 GATGCTCTAAATCTTGAGAGAGG - Intergenic
1112172500 13:96988927-96988949 GTATCTCTAGGACTTGACAGAGG - Intronic
1119670655 14:76515726-76515748 GTGTCTCTAGACAATGCGAGAGG + Intergenic
1124038400 15:26078017-26078039 GGCTCACTAGGCCTTGAGAGTGG + Intergenic
1127642639 15:60930346-60930368 GCTTATATAGACCTTGAGAATGG - Intronic
1129629553 15:77243878-77243900 GAATCTCTTGAACTTGAGAGGGG + Intronic
1131392578 15:92061470-92061492 GTCTCTCAGGACCTTCAGAGGGG - Intronic
1131458502 15:92602064-92602086 GTCTCTCTAGATGTTCAGAGGGG - Intergenic
1134410830 16:14001974-14001996 TTTTCTACAGACCATGAGAGGGG - Intergenic
1134422040 16:14102482-14102504 TTTTCTTGAGTCCTTGAGAGGGG - Intronic
1136277316 16:29186676-29186698 GTTTCTCTAGAAATGAAGAGAGG - Intergenic
1139966777 16:70750111-70750133 TTTCCTCCAGGCCTTGAGAGGGG - Intronic
1141738644 16:85873738-85873760 GTTTTTCTGTACCTTGACAGGGG + Intergenic
1145968449 17:28938596-28938618 GTTTCTATAGACCCTGTCAGGGG - Intronic
1150432814 17:65131958-65131980 CTTTTTCCAGACTTTGAGAGGGG + Intergenic
1153940207 18:9970283-9970305 CTTTCTCTTGTGCTTGAGAGAGG - Intergenic
1160632280 18:80254857-80254879 CTGTCTCAAGACCTTGAGAGAGG + Intergenic
1161558006 19:4955303-4955325 GTGCCTCTAGACCTTGGGAAAGG - Intronic
1164365069 19:27570558-27570580 GTTTTTCTAGAACCTGAGAAGGG + Intergenic
1166368672 19:42290012-42290034 GTTTCTCCCGGGCTTGAGAGAGG + Intronic
1167482459 19:49741544-49741566 TTTTCTCTAAACTTTTAGAGAGG - Intronic
1167823993 19:51955146-51955168 GTCTCTCTAGAACTTCATAGGGG - Intergenic
938129644 2:128702727-128702749 GGTTCTGTAGATCTGGAGAGAGG + Intergenic
939098061 2:137858802-137858824 GTTTATATAGACATAGAGAGTGG - Intergenic
939468447 2:142588226-142588248 GTTTCTCCAGAAATTCAGAGAGG + Intergenic
944418625 2:199504637-199504659 ATTTCTCTAGACCTTTAGAAGGG - Intergenic
944421857 2:199539415-199539437 GATTCTCTCAACCTAGAGAGAGG - Intergenic
948359770 2:237412041-237412063 GCTTCTCTCGACCATGAGTGAGG + Intronic
1169418957 20:5443721-5443743 GTTTCTCCAGACCACGACAGAGG + Intergenic
1169527976 20:6451188-6451210 GTTTCTTTACATCTTGAGACAGG + Intergenic
1169607626 20:7340258-7340280 GGTTCTCAAGCCCTTGACAGTGG - Intergenic
1169640340 20:7744039-7744061 GTTTGGCAAGACCTTGAAAGAGG + Intergenic
1172395675 20:34602770-34602792 CTTTCTCTCGACCTTGGTAGTGG - Intronic
1172428304 20:34871242-34871264 GTCTCTCTTGACCTAGAGATTGG - Intronic
1175604296 20:60299591-60299613 GTTTCCATTGACCTGGAGAGAGG + Intergenic
1176252377 20:64131897-64131919 GTCTCTATAGGCCATGAGAGTGG - Intergenic
1176252513 20:64132471-64132493 GTCTCTATAGGCCATGAGAGTGG - Intergenic
1176924101 21:14725678-14725700 GTATCTGTAGACCATGATAGAGG - Intergenic
1177068149 21:16465546-16465568 GCTTCTGTAGGCCTGGAGAGGGG + Intergenic
1177368102 21:20164875-20164897 GTGTCTGTGGCCCTTGAGAGTGG - Intergenic
1177691446 21:24514028-24514050 GTTTCTTAATATCTTGAGAGTGG - Intergenic
1178491473 21:33055361-33055383 ATTTCTCAAGACCCTGAGGGTGG + Intergenic
1178513144 21:33224036-33224058 GTTTCACAAGAACTTGAGAATGG + Intergenic
1181388893 22:22564871-22564893 GGTTCTCTCCACCTGGAGAGAGG - Exonic
1181531767 22:23521337-23521359 GTTTCTCTCAACTTTGGGAGGGG + Intergenic
1185116512 22:48941230-48941252 GTATCTCTACATCTTGAAAGAGG + Intergenic
949429143 3:3954093-3954115 TTTTCTCCAGACCTTCAGAATGG + Intronic
949599203 3:5580225-5580247 TTTGCTAGAGACCTTGAGAGAGG - Intergenic
949743809 3:7265481-7265503 CTGTCTCATGACCTTGAGAGAGG + Intronic
949826519 3:8171169-8171191 GTTTGTCTAGCCCTTTAGAAGGG + Intergenic
950363992 3:12470170-12470192 ATTTTTCTAATCCTTGAGAGTGG + Intergenic
951536335 3:23744134-23744156 GTTTCTCTAGGGCCAGAGAGAGG + Intergenic
952301757 3:32109610-32109632 GTTACTCCAGTCCTAGAGAGAGG + Intronic
958652727 3:96958638-96958660 GTTTGTCTAGTTCTTGAGATGGG - Intronic
961800125 3:129440959-129440981 GTTTCTCTAAAACTGGAGATGGG + Intronic
962002744 3:131316366-131316388 GTTTCTCTAAAGCTGGGGAGGGG - Intronic
962137650 3:132754037-132754059 TTTTCTCTTGACCTAGAAAGGGG - Intergenic
962840505 3:139228178-139228200 CTTTCTCCAGAACTTGAAAGGGG - Intronic
966995954 3:185280827-185280849 GTATCCCAAGACTTTGAGAGAGG - Intronic
972812826 4:42609234-42609256 GTTTCTGTAGGCCTGGAGTGGGG - Intronic
977037073 4:91967733-91967755 GTTTCTCTACTCCTTAAGTGTGG + Intergenic
978978814 4:114916150-114916172 CTTTCACCAGACCATGAGAGTGG - Intronic
980900373 4:138899676-138899698 GTTTATCTAGCACTTGTGAGAGG - Intergenic
981567794 4:146118772-146118794 ATTTATCTAGATCTTGGGAGGGG + Intergenic
985106803 4:186507798-186507820 TTTTCTATAGACTTTTAGAGAGG + Intronic
988339652 5:29953861-29953883 GTTTCTGTAGAACTTTAAAGTGG + Intergenic
989834152 5:45963237-45963259 GTTTTTGTAGACCCTGTGAGGGG + Intergenic
994169766 5:96645791-96645813 TTGTGTCTAGACCTTTAGAGAGG - Intronic
994690992 5:103019173-103019195 CTTTCTGTAGATCTTGAGTGGGG - Intronic
995530043 5:113083370-113083392 GTTTCTGTAGCCCAGGAGAGGGG + Intronic
996209438 5:120787893-120787915 GTTTCTGAAGAGCTTGACAGAGG - Intergenic
996226286 5:121001240-121001262 GTTTCTCTAGAAGTTGATAGGGG + Intergenic
996393104 5:122985233-122985255 CTTTCACCAGAGCTTGAGAGAGG + Intronic
997449331 5:133968948-133968970 GTTTCTTTCGCCTTTGAGAGAGG - Intergenic
999447833 5:151654792-151654814 GTTTCTCTAGTCCTGGGGAGGGG + Intergenic
1000477005 5:161722353-161722375 TTTTCTATAAACCTTAAGAGAGG + Intergenic
1000947860 5:167444176-167444198 GTTTCTCAAGACTTTGATGGTGG - Intronic
1004151081 6:13120588-13120610 TTTTCGCTAGCCCTTGAGTGTGG + Intronic
1007272621 6:40649919-40649941 GTTTCTCTAGACATTTAGGGCGG - Intergenic
1008873247 6:56297938-56297960 ATTTCTCTAGACCTTAGAAGGGG + Intronic
1009240469 6:61179972-61179994 GTTTCTCTGAACCCTGAGGGAGG + Intergenic
1013837243 6:114346801-114346823 ACTTGTCTAGACCTAGAGAGAGG - Intergenic
1015352750 6:132241973-132241995 CTTTGTCTATTCCTTGAGAGTGG + Intergenic
1019942108 7:4299725-4299747 GTTTCTCTCTGCCTTGAGACTGG - Intergenic
1020488983 7:8755865-8755887 GTTTCTCTAGACCTTGCTCATGG - Intergenic
1021041744 7:15871360-15871382 TTTTCTTTAGACTCTGAGAGGGG - Intergenic
1021110308 7:16686414-16686436 GTTTCTCTAGACCTTGAGAGGGG - Intronic
1024137185 7:46422111-46422133 GCTTCTCTAGACCTTTATAGGGG - Intergenic
1025583590 7:62751953-62751975 GTTTCTGTAGAATATGAGAGTGG + Intergenic
1025605751 7:63038852-63038874 GTCTCTCTGGACCTGGAGTGTGG - Intergenic
1025912991 7:65842332-65842354 CTGTCTCTTAACCTTGAGAGTGG + Intergenic
1027305503 7:76892244-76892266 GGGTGTCTAGACCTTGAGAATGG + Intergenic
1028510863 7:91624883-91624905 GATTCTGTAGATCTTGAGATGGG - Intergenic
1038383684 8:27120763-27120785 GGTTCTCTGGGCCATGAGAGTGG - Intergenic
1049010681 8:139884996-139885018 GTGTCTCTAGCCCATGAAAGGGG + Intronic
1053238846 9:36479597-36479619 GATTCTCAAGACCTTAAGTGAGG + Intronic
1057623119 9:96654650-96654672 GCTTCTGCAGACCTTGCGAGCGG - Intronic
1057871254 9:98719889-98719911 GTGTCTCTAAACTTTGGGAGGGG + Intergenic
1059738989 9:117131193-117131215 GTTTCTCTTGGCTTTGAGTGTGG - Intronic
1189751805 X:44230156-44230178 TTTTCTCTAGATCTTTAGAATGG + Intronic
1193436137 X:81477230-81477252 GTGTTTCTAGAGCTTGAAAGGGG + Intergenic
1195167784 X:102237639-102237661 GTGTCTCTATGCCCTGAGAGAGG - Intergenic
1195191073 X:102449448-102449470 GTGTCTCTATGCCCTGAGAGAGG + Intronic
1196232572 X:113240839-113240861 GCATCTCTGGGCCTTGAGAGAGG - Intergenic
1198131416 X:133699185-133699207 GTTCCTATTGACCTTGAGGGGGG - Intronic
1201966226 Y:19739462-19739484 GTTCATCTAGACCTTGATATTGG - Intronic