ID: 1021112529

View in Genome Browser
Species Human (GRCh38)
Location 7:16711915-16711937
Sequence CTGAATCAGCATGAGCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021112529_1021112533 9 Left 1021112529 7:16711915-16711937 CCTCCCAGCTCATGCTGATTCAG No data
Right 1021112533 7:16711947-16711969 CCACATCTTCTCTGAACTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021112529 Original CRISPR CTGAATCAGCATGAGCTGGG AGG (reversed) Intergenic
No off target data available for this crispr