ID: 1021119099

View in Genome Browser
Species Human (GRCh38)
Location 7:16777795-16777817
Sequence TAGGGTCAGCTTCTGGAGGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 167}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021119099 Original CRISPR TAGGGTCAGCTTCTGGAGGT TGG Exonic
900335842 1:2163001-2163023 CAGGGTTAGCATCTGCAGGTGGG + Intronic
900341423 1:2191110-2191132 TAGAGAAAGCTTCTGGAGGGAGG - Intronic
901061178 1:6472611-6472633 CCGGGTCAGCTTCTAGAGGGAGG + Exonic
904286253 1:29454855-29454877 GAGGGGCAGCTTGGGGAGGTGGG - Intergenic
904417987 1:30374525-30374547 GAGGGGCAGCTTGGGGAGGTGGG + Intergenic
906156950 1:43619506-43619528 TTGGCCCAGCTTCTGGATGTGGG - Exonic
911051493 1:93675496-93675518 TAGGGTCAGGGTCAGGAGGTGGG + Intronic
913550736 1:119915189-119915211 TGGAGCCAGCTTCTAGAGGTAGG - Exonic
915377803 1:155412763-155412785 TAGGGTCAGATCCTATAGGTTGG - Intronic
917581828 1:176386689-176386711 TAGTCTCAGCTACTGGAGGCTGG + Intergenic
918404852 1:184201574-184201596 TAGGGTGTTCTTCTGGAGGAGGG - Intergenic
920355585 1:205369553-205369575 TTGGGTAAGCTTCTTGAGGGAGG + Intergenic
922241736 1:223759908-223759930 TAGGGAGAGGTTCTGGAGGTGGG - Intronic
922868186 1:228878511-228878533 AAGGGTCAGCTTCAGGAAGCAGG - Intergenic
1064750019 10:18519175-18519197 CAAGGTCAGCTTATGGATGTAGG - Intronic
1066785230 10:38995898-38995920 TATGCTCAGCAGCTGGAGGTAGG + Intergenic
1067037371 10:42930590-42930612 TAGGGCCAACTTGTGTAGGTAGG + Intergenic
1067045186 10:42981439-42981461 GAGGCGCAGCTTCTGGAGCTGGG + Intergenic
1067371745 10:45690403-45690425 TATGCTCAGCAGCTGGAGGTAGG + Intergenic
1067388036 10:45835746-45835768 TATGCTCAGCAGCTGGAGGTAGG - Intronic
1067418085 10:46121534-46121556 TATGCTCAGCAGCTGGAGGTAGG + Intergenic
1067446229 10:46348855-46348877 TATGCTCAGCAGCTGGAGGTAGG + Intergenic
1067503444 10:46828097-46828119 TATGCTCAGCAGCTGGAGGTAGG + Intergenic
1067591149 10:47511916-47511938 TATGCTCAGCAGCTGGAGGTAGG - Intronic
1067638267 10:48020008-48020030 TATGCTCAGCAGCTGGAGGTAGG - Intergenic
1067875227 10:50000353-50000375 TATGCTCAGCAGCTGGAGGTAGG + Intronic
1069535373 10:69249012-69249034 TGGGGTCAGGATCTGGGGGTCGG - Intronic
1070134872 10:73684434-73684456 TATGCTCAGCAGCTGGAGGTAGG - Intronic
1071517460 10:86308201-86308223 GAGGAACTGCTTCTGGAGGTGGG - Intronic
1072066094 10:91872954-91872976 TAGCCTCAGCTACTAGAGGTGGG + Intergenic
1077130216 11:968296-968318 TGGGCTCAGCTTCTAAAGGTGGG + Intronic
1078098237 11:8313414-8313436 CAGGGTCAGGCTCTGGGGGTGGG + Intergenic
1079423329 11:20315864-20315886 AAGGGACAGCTTCTGAAGCTCGG + Intergenic
1080616446 11:33948805-33948827 TAGTGTAAGTTTCTGGAGGGTGG - Intergenic
1080894331 11:36436500-36436522 TAGGGACAGCATCAGGAGGCAGG + Intronic
1081914881 11:46724317-46724339 TAGGGTCAACTGACGGAGGTTGG + Intronic
1085401495 11:76238624-76238646 TCAGGGCAGCATCTGGAGGTGGG - Intergenic
1085830912 11:79899950-79899972 TTGGGTAAGCTTGTGAAGGTGGG + Intergenic
1094725249 12:33107894-33107916 TAGGGTCTGCCTCTGGGGGCAGG - Intergenic
1097727631 12:63093146-63093168 TGGGGTAAGCAGCTGGAGGTGGG - Intergenic
1101880126 12:108620722-108620744 CAGGGTGAGCTTCTGGAGAGTGG + Intergenic
1102658127 12:114501026-114501048 CAGGGTCAGCCTCTGCAGTTTGG - Intergenic
1116169709 14:41384561-41384583 CAGGGTGAGGTTCTTGAGGTAGG + Intergenic
1116844677 14:49853979-49854001 TAGAGTCGCCTTCTGGTGGTAGG - Intergenic
1118708870 14:68503427-68503449 TAGCATCAGCCTCTGGAGGAGGG - Intronic
1121433397 14:93903157-93903179 CCGGGTCATCTCCTGGAGGTGGG - Intergenic
1121970999 14:98355731-98355753 TGTGGGCAGCCTCTGGAGGTTGG - Intergenic
1122023498 14:98858521-98858543 CAGGGTGAGCTTCTGGGGTTGGG + Intergenic
1122939369 14:104974374-104974396 CAGCGTCAGCTGCTGGAGGGAGG - Intronic
1124907765 15:33887265-33887287 AAGGGTCAGCTTCTAGGGGAGGG + Intronic
1126448330 15:48776400-48776422 TAGGGACAGCCTCAGGACGTGGG + Intronic
1131566879 15:93493868-93493890 GAGGGTCAGTTTCTTGAGGAAGG + Intergenic
1132200025 15:99945139-99945161 TAGGTTAAGGTTCTTGAGGTGGG + Intergenic
1132850804 16:2024081-2024103 TAGGGTCAGCATCGAGAGGAGGG - Intergenic
1132941351 16:2510004-2510026 TAGGGTGGGCTTCTGCAGGAGGG - Intronic
1133449926 16:5895372-5895394 TAAGATGAGCTTCTGGAAGTAGG + Intergenic
1137925036 16:52532475-52532497 GAGGGTTTGCTTCAGGAGGTTGG - Intronic
1142563825 17:826824-826846 TACTGTCAGATTCTTGAGGTTGG + Intronic
1143181411 17:4986601-4986623 TTGGGTCAGGTCCTGGGGGTTGG + Intronic
1143871900 17:9962929-9962951 TAGGTTCAGGTTCTGGAGTTTGG - Intronic
1144357644 17:14461316-14461338 GAGGGTCAGATCATGGAGGTGGG + Intergenic
1145296048 17:21593358-21593380 CAGGGTCAGCTTCTGGGGCTGGG - Intergenic
1145367746 17:22278703-22278725 CAGGGTCAGCTTCTGGGGCTGGG + Intergenic
1146466269 17:33089127-33089149 TAGTCACAGTTTCTGGAGGTGGG - Intronic
1148190056 17:45672137-45672159 GAGGGGCAGCTGCTGGAGCTGGG - Intergenic
1150361722 17:64541060-64541082 TAGTCCCAGCTACTGGAGGTGGG - Intronic
1150429396 17:65103128-65103150 CAGGGGCTGCTTCTGCAGGTGGG - Intergenic
1154216435 18:12419967-12419989 TAGTCCCAGCTACTGGAGGTGGG + Intronic
1155924888 18:31645008-31645030 TAGGGACAGCTGCAGGAGGCAGG + Intronic
1156346564 18:36262310-36262332 TAGTCTCAGCTCCTTGAGGTGGG + Intronic
1160541583 18:79626932-79626954 TCGGTGCAGATTCTGGAGGTGGG - Intergenic
1161605385 19:5212010-5212032 CTGGGCCAGCTTCTGGATGTAGG + Exonic
1161644741 19:5446101-5446123 TAGCAACAGCCTCTGGAGGTGGG + Intergenic
1166975586 19:46603288-46603310 TTGGGTCCTATTCTGGAGGTAGG - Intronic
1167029433 19:46947687-46947709 TAGTGTCAGATCCTGCAGGTTGG + Intronic
1167244096 19:48363601-48363623 TAGAGACGGCTTCTGGAGGGTGG - Intronic
1167550633 19:50158249-50158271 TTTGGTAAGCTTCTGGGGGTGGG - Exonic
926072687 2:9912224-9912246 AAGTGTGAGCTTCTGGAGGGAGG + Intronic
927707556 2:25306222-25306244 TGGGATCAGCCTCTGCAGGTTGG - Intronic
929030878 2:37649011-37649033 TGGGGTCAGCTGATGGAGGCAGG + Intronic
930854791 2:56002946-56002968 TAAGTTCAGGTTCAGGAGGTAGG - Intergenic
933037588 2:77419948-77419970 TGGGGACAGTTTCTGAAGGTGGG + Intronic
934556107 2:95287779-95287801 AAGGGTCTGCATCGGGAGGTGGG - Intronic
941165095 2:162075421-162075443 TAGTTTCAGCCTCTGGAGTTGGG - Intergenic
943326762 2:186508552-186508574 TAAGTGAAGCTTCTGGAGGTAGG + Exonic
944894068 2:204146017-204146039 AAGGGTCAGCCGCTGGAGGGTGG - Intergenic
946642086 2:221794783-221794805 TAGTCTCAGCTACTGGGGGTGGG + Intergenic
947380416 2:229540143-229540165 TAGGGACAGCTTCTAGAAGCAGG + Intronic
949009668 2:241671382-241671404 TAGGGACAGGTTCAGGACGTCGG - Exonic
1171115715 20:22523311-22523333 TAGGGTCAGCTGCTTGGGGCTGG - Intergenic
1173027923 20:39326446-39326468 TTGGGTCAGCATGTGAAGGTGGG + Intergenic
1173258285 20:41410717-41410739 AAGGGTCAGCATCTGTAGGGAGG + Intronic
1174200767 20:48804949-48804971 TCGGGTCATCATCTAGAGGTCGG + Intronic
1177183034 21:17764060-17764082 TGGGGCCAGCTTCTGGAGTAAGG - Intergenic
1180997738 22:19973842-19973864 AGCGGTCAGCGTCTGGAGGTGGG - Intronic
1182511681 22:30824556-30824578 AGGGGTCAGCTTTGGGAGGTGGG + Intronic
1182547090 22:31082735-31082757 CAGGCTCAGCTTCTGGCTGTGGG - Intronic
1184895928 22:47406433-47406455 TTGGGGCAGCGTCAGGAGGTTGG - Intergenic
950668423 3:14511121-14511143 AAGGGTGGGCCTCTGGAGGTAGG + Intronic
951804332 3:26627830-26627852 AAGGGTGACCTTCTGGAGGTGGG + Intronic
952919596 3:38275633-38275655 CAGGGTCACCTTCCGGAGCTGGG - Exonic
954692670 3:52403977-52403999 TAGGGTCAGCCCCTGGAGGTCGG - Intronic
955489160 3:59465186-59465208 TAGGTTCAGCTTTAGGAAGTTGG - Intergenic
960094896 3:113679754-113679776 TAGGGTTTGCTTCTGGAGTAGGG - Intronic
961365629 3:126397767-126397789 TGGGGTCAGCTGCAGGAGCTGGG + Intronic
962037607 3:131669165-131669187 GTGGTTCTGCTTCTGGAGGTTGG - Intronic
962428548 3:135297837-135297859 TGGGTCCAGCTTCTGGAGGGAGG + Intergenic
962478700 3:135780027-135780049 CAGGGACAGCTTTTTGAGGTAGG - Intergenic
963866370 3:150366442-150366464 TAGTCTCAGCTACTGGAGGAGGG - Intergenic
966355468 3:179074108-179074130 TAGGGGCAGCTTCTTCAGCTTGG - Intergenic
968007985 3:195255937-195255959 TATGGGCAGCTCCTGGAGGAGGG + Intronic
968555503 4:1244652-1244674 TAGGGTGCCCTTCTGGTGGTCGG - Intronic
969043202 4:4317252-4317274 TGAGGTCAGCTTCTGGGGGATGG + Intronic
975882670 4:78929131-78929153 CACGGACAGCTTCTGGGGGTTGG + Intronic
976215279 4:82710318-82710340 GAGAGTCAGCATCTGGTGGTGGG - Intronic
977863791 4:101999276-101999298 TAGAGGCAGCTTCTAGAAGTTGG - Intronic
977961025 4:103085618-103085640 TAGAGTCAGTTTCTGGATCTAGG + Intronic
986929926 5:12805362-12805384 CAGGGGCAGCGTCTGGAGGCTGG - Intergenic
988463341 5:31462702-31462724 TAGGGACTGCTACAGGAGGTGGG + Intronic
988919102 5:35924488-35924510 TAGGGTCAGCCTCAAGAGGTGGG - Intronic
990325049 5:54666934-54666956 CACAGTCATCTTCTGGAGGTAGG + Intergenic
992996056 5:82334670-82334692 TAGGGTATGTTTCAGGAGGTCGG + Intronic
996341480 5:122443797-122443819 GAGAGTCAGCATCTGAAGGTTGG - Intronic
998158397 5:139799224-139799246 TAGATGAAGCTTCTGGAGGTAGG - Intronic
1000469998 5:161629403-161629425 ATAGCTCAGCTTCTGGAGGTAGG + Intronic
1001450793 5:171822880-171822902 CAGGGCCACCTTCTGGAGCTGGG + Intergenic
1003185179 6:3824156-3824178 TGGGGTCAGCTTCAGCAGGCTGG - Intergenic
1003200008 6:3950740-3950762 GAGGGTCAGTTTCTTGAGGAAGG - Intergenic
1006720343 6:36145915-36145937 ATGGGTCACCTTCTGGAGCTGGG - Intergenic
1006966398 6:37990129-37990151 GAGAGTCAAATTCTGGAGGTGGG - Intronic
1010296680 6:74206802-74206824 AAGGGATAGCTTCTGGAAGTGGG + Intergenic
1011500290 6:87980987-87981009 GAGGGTCAGATTTTGCAGGTGGG + Intergenic
1016858166 6:148692882-148692904 TGGGATCAGCTGCTGGAGATGGG + Intergenic
1018073874 6:160191850-160191872 TTGGGTCAGCTTGCTGAGGTTGG - Intronic
1018654862 6:166025360-166025382 ATGGGTCAGCTTTTGGTGGTTGG - Intergenic
1019539419 7:1545132-1545154 GAGGGGCAGTTTCTGGAGGCTGG - Exonic
1019764880 7:2843293-2843315 TCGGGCCAGCTTCTGGGGATGGG - Intronic
1021119099 7:16777795-16777817 TAGGGTCAGCTTCTGGAGGTTGG + Exonic
1021968578 7:25945950-25945972 ATGTGTCAGCTTCTGGATGTAGG - Intergenic
1024756013 7:52532367-52532389 TAGGGTCAGCTTCCTGAGGAAGG - Intergenic
1026111856 7:67464813-67464835 TTGGCTTGGCTTCTGGAGGTTGG - Intergenic
1026664315 7:72329440-72329462 TAGGGTCACCCTGTGGAGTTTGG - Intronic
1029192440 7:98781280-98781302 TGGGCTCAGCTTCTAGAGGGTGG - Intergenic
1030932479 7:115542182-115542204 CAGGGTCAGCTTTTAGAGGATGG - Intergenic
1031608735 7:123800038-123800060 TAGTTTCAGCTATTGGAGGTGGG + Intergenic
1032476788 7:132216899-132216921 AAGGGCCAGCTTTTGGAGGATGG + Intronic
1033272330 7:139943912-139943934 AAGGGTCAGCTGCTGGGGGTGGG - Intronic
1033524742 7:142199506-142199528 TAGGATCAGATCCTGGAGGGTGG + Intronic
1033555027 7:142481828-142481850 TGGGGTCAGCTTCTGAAGGCAGG + Intergenic
1033596456 7:142863043-142863065 CGGGGTCAGCTTTTGGAGCTTGG + Intronic
1035422651 7:158742294-158742316 GAGGGTCAGCTTCAGGGGGGTGG - Intronic
1036519779 8:9480409-9480431 TAGTGTCAATTTCTGGAGATTGG - Intergenic
1037003745 8:13751328-13751350 TAGGGGCAGAGTCTGGGGGTGGG - Intergenic
1037549725 8:19958465-19958487 TAGGGACAGCCTCTGGAAGCAGG - Intronic
1037763430 8:21757043-21757065 TAGGGCCAGGAGCTGGAGGTTGG - Intronic
1044587941 8:93885320-93885342 TAGAGTCAGATTTTGGAGGAAGG + Intronic
1044708927 8:95036529-95036551 TAGGTTGAGCTTCTTGAAGTGGG - Intronic
1045511321 8:102814199-102814221 TAGGGTCAGGTTGTTGAGGTGGG - Intergenic
1048319904 8:133390546-133390568 TAGGGTCATTTTCAGGAGGGAGG - Intergenic
1049428152 8:142546590-142546612 CTGGGGCAGGTTCTGGAGGTGGG + Intergenic
1050701246 9:8341738-8341760 TTGTGTCAGCTTCTGAATGTAGG + Exonic
1051078155 9:13265057-13265079 TATGGGCAGCCTCTGGAGTTTGG - Intronic
1051156525 9:14153562-14153584 TAGGATCAGCTTTTGGAGTGAGG - Intronic
1052230980 9:26152434-26152456 TAGAGTGAGATTCTTGAGGTGGG - Intergenic
1053171794 9:35892308-35892330 TAGGGTCTGATGCTGGAGGCTGG + Intergenic
1053480768 9:38414772-38414794 TTGGGTCGGCTTCTGGGGATGGG - Intronic
1056751574 9:89355426-89355448 GAGGGTCAGCATCAGGAGCTTGG + Intronic
1056988908 9:91391292-91391314 CAGGGTCAGCTCCCAGAGGTGGG + Intergenic
1058146172 9:101413999-101414021 TAAGAACAGCTTCTGGAGTTAGG + Intergenic
1058913925 9:109547080-109547102 TATGGTCAGCTTTGGGATGTGGG + Intergenic
1062028892 9:134353078-134353100 CAGGGTCCCCTTCTGGAGGGGGG + Intronic
1062258662 9:135645355-135645377 TAGTGTCAAGTGCTGGAGGTAGG - Intergenic
1186178086 X:6946036-6946058 TAGGGGCAGCATCGGGCGGTTGG - Intergenic
1187365023 X:18659749-18659771 TATGGCCAGCTTCAGGAGGGAGG - Intronic
1192292801 X:69815412-69815434 CTGGGACAGCTTCTGGAGTTGGG + Intronic
1192551818 X:72060704-72060726 TGGGGGCATCTCCTGGAGGTTGG - Intergenic
1196410263 X:115411195-115411217 GAGGGTCAGCATCAGGAGGTTGG + Intergenic
1197652279 X:129078389-129078411 TAGGGTCTGGGTCTGGAAGTGGG - Intergenic
1198836968 X:140815861-140815883 TAGGGTAATGTTCTGGAGGAAGG + Intergenic
1199996058 X:153027662-153027684 TAGGGGCAGCGTCTGGAAGCTGG - Intergenic
1200667756 Y:6048490-6048512 TAGGGTCAACTGTTGGTGGTGGG - Intergenic