ID: 1021121223

View in Genome Browser
Species Human (GRCh38)
Location 7:16797950-16797972
Sequence CTGTGTTTGGGGAAGACATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 212}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021121223 Original CRISPR CTGTGTTTGGGGAAGACATC TGG Intronic
902267276 1:15276626-15276648 TTGTGTTTTGGGTAGACATGGGG - Intronic
904089839 1:27937091-27937113 CTGTGCTTCAGGAAGACACCTGG - Intronic
904447490 1:30586969-30586991 CGGCGTTTGGGGAAGGCACCTGG - Intergenic
904543976 1:31253928-31253950 CTGTGTTTTAGCAAGCCATCTGG - Intergenic
905865781 1:41375857-41375879 CTGTGTTGGGAGAAGAAATGAGG + Intronic
906103968 1:43280617-43280639 CTGTACTTGGGGAACACATGGGG + Intergenic
907325304 1:53634133-53634155 ACGGGTTTGGGGAGGACATCAGG + Intronic
907616946 1:55935538-55935560 CTGTCTTTGGACAAGACATGTGG - Intergenic
908686424 1:66725239-66725261 CTGGGTTTGGGGCAGAGATTGGG - Intronic
910847538 1:91617759-91617781 CTGTATTTGGGGAAGTCTTCAGG + Intergenic
912137479 1:106679661-106679683 CTGTGTTTGGGGAAAGGATTTGG - Intergenic
914001562 1:143698998-143699020 CTGTTCTTTGGGAAGAAATCAGG - Intergenic
914847730 1:151292193-151292215 CTGGGTTTGGGGAAGGAGTCAGG + Exonic
915312465 1:155011440-155011462 CTTGGTTGGGGGAAGACTTCAGG - Intronic
915543096 1:156581361-156581383 CAGGGTTGGGGGAAGACATAGGG - Exonic
916039742 1:160951801-160951823 CCATGTTTGGGGAAGACCACAGG - Intronic
916602539 1:166306967-166306989 CTGTCTTTGGGGAAGGTTTCTGG + Intergenic
917184367 1:172336615-172336637 CTGTGATTAGGTAAGATATCAGG - Intronic
917403967 1:174683529-174683551 CTGTGTATGATGAAGACATTGGG + Exonic
917634035 1:176917842-176917864 CTGTGTTTGGTGAAGGCACGTGG - Intronic
919097382 1:193054421-193054443 CTGGGGTTGTGGAAGACATATGG - Intronic
919917548 1:202148102-202148124 CTGTGCTTGGGCAGGACCTCGGG + Exonic
921056763 1:211548464-211548486 CTGTGTTTGGGAAAGTCCCCTGG + Intergenic
921180111 1:212625464-212625486 CTGTGTTTCAGGAAGACAGGAGG + Exonic
924925336 1:248674859-248674881 CTGTGTTTGGGGAGCACTACGGG - Intergenic
1062971343 10:1651587-1651609 CTGTATGTGGGAAAGACAGCTGG - Intronic
1064578451 10:16769543-16769565 CTGTGTTTTAGCAAGCCATCTGG - Intronic
1065077788 10:22098347-22098369 ATGTGGGTAGGGAAGACATCTGG + Intergenic
1066479850 10:35785387-35785409 CTGTTTTTGGAGAAGGCAGCAGG - Intergenic
1068262070 10:54595351-54595373 CTTTGTTAGTGGAAGACTTCAGG - Intronic
1069237174 10:66091193-66091215 AGGTGTTTGTGGTAGACATCTGG - Intronic
1069776152 10:70928467-70928489 CTGTGTTTGGGGAGGGGAGCAGG + Intergenic
1075677746 10:124307998-124308020 CTGTGTCTGGGGAAGGTGTCAGG + Intergenic
1077632449 11:3819976-3819998 CAGAGTTTGGGGAAGGCCTCAGG - Intronic
1077815042 11:5678783-5678805 CTCTACTTGGGGAAGACATTTGG - Intronic
1077922099 11:6649348-6649370 CTGTTTTAGGAGAATACATCTGG + Intronic
1078087177 11:8241123-8241145 CCAGGTTTGGGGAAGAAATCAGG - Intronic
1079375806 11:19890799-19890821 CTGTGTTTGGGGACCAGATGTGG - Intronic
1080270725 11:30448369-30448391 GTGTGTTTGTGGAACTCATCAGG - Intronic
1080392477 11:31861122-31861144 CTGTGTTTGAGGAACACGCCAGG - Intronic
1082770885 11:57206666-57206688 CCGTGTCTGGAGACGACATCGGG - Intergenic
1083876908 11:65529079-65529101 CCGTGTGTGGGGAAGACAGCGGG + Intronic
1085281880 11:75336331-75336353 CAGGGTGTGGGGAGGACATCAGG - Intronic
1085784105 11:79436840-79436862 CTGTGGTGGGGGAAGGGATCAGG - Intronic
1087154998 11:94893919-94893941 CTGTGTTTGTGGAAGCCATCAGG + Intergenic
1087653449 11:100895639-100895661 GTGTATTTGAGGAAGGCATCTGG + Intronic
1088202088 11:107348949-107348971 CTTTGTTGGATGAAGACATCTGG - Exonic
1088279561 11:108122292-108122314 TTGTGTTTAGGGAACACAGCAGG + Intronic
1089762704 11:120740016-120740038 CTGTGTTTGGGAAACACAGATGG + Intronic
1089856033 11:121545480-121545502 CAGTGTTGGGGGAAGAGATTAGG + Intronic
1089935566 11:122360519-122360541 CTGTGTGTGAGGAAGAAATCAGG - Intergenic
1090563130 11:127955524-127955546 CTCTTTTTGGAGAAGACATGAGG + Intergenic
1091057389 11:132431517-132431539 CTCTGTGTGGGGAAGGCAACCGG + Intronic
1091152222 11:133339451-133339473 CTGTGTTTGGGGGAAACAGTGGG - Intronic
1092013358 12:5135657-5135679 GTGTGTTTGGTGAAGACATTTGG - Intergenic
1092037409 12:5348878-5348900 CAGTATTTGGGGAAGAGATGGGG + Intergenic
1092167896 12:6354341-6354363 CTGTTTGTGGGGATGACTTCTGG - Intronic
1096907936 12:54952933-54952955 TTGTGTTTGGGGAAGAAAAATGG - Intronic
1097187347 12:57202903-57202925 CTGTGTTTGGGGAGGGGAGCGGG - Intronic
1097327824 12:58298914-58298936 CAGTGTATGGGGCAGACATGAGG - Intergenic
1097937438 12:65269569-65269591 CTGTGTCTGGGAAAGACCCCAGG + Intergenic
1100762009 12:97818423-97818445 CTGTGCTAGGGGAAAAAATCTGG + Intergenic
1101186302 12:102284210-102284232 CTATGTCTGGGAAGGACATCAGG - Intergenic
1101234058 12:102770363-102770385 TTGTGTTAGGGGATGACATGGGG - Intergenic
1101714314 12:107297283-107297305 TTGAGTTTGGAGAAGTCATCAGG - Intergenic
1102576094 12:113857063-113857085 CTGTGCTTGGGGGAGAAATGAGG - Intronic
1104170545 12:126276097-126276119 CTGTATCTGGGGAAGACTGCAGG + Intergenic
1104358590 12:128111196-128111218 CTGTGTTTGGGGGAGACCCAGGG - Intergenic
1104774994 12:131385763-131385785 CGGTGCTTGTGGAGGACATCTGG - Intergenic
1106847529 13:33752210-33752232 CTGTGTTTAGGTAATATATCAGG + Intergenic
1107635940 13:42392698-42392720 CTGTGTTTGGAGTAGAGATGAGG + Intergenic
1110290674 13:73803428-73803450 AGGTGTTTGGGGAAGAACTCTGG - Intronic
1110570932 13:77002617-77002639 CTGTATTTGAGGAAGATATCTGG - Intronic
1114647832 14:24265378-24265400 CAGTGTTTGGGGCAGAATTCAGG - Intergenic
1115961411 14:38838387-38838409 CTGAGTTTGCGGAAGAAACCAGG - Intergenic
1117739213 14:58798814-58798836 CTCAGTTTGGGAAAGACATTTGG - Intergenic
1118511630 14:66480986-66481008 CTGTGATTGGAGAAGAAACCTGG + Intergenic
1119434554 14:74589567-74589589 TTGTGTTTGGGGAAGTGCTCTGG - Intronic
1126333204 15:47556376-47556398 CTGTGTTTGATGAATACATAAGG + Intronic
1126806338 15:52353035-52353057 CTGTGTTTGAACAAGACCTCTGG - Intronic
1126932252 15:53667847-53667869 TTGTATTTGGGTAAGACATTAGG - Intronic
1128187409 15:65654500-65654522 GTGTGTTTGGGGCAGAGGTCAGG - Exonic
1130125741 15:81092719-81092741 CTGTCCTTGGGGAAGTCATTTGG - Intronic
1131888761 15:96949286-96949308 ATGTGTTTGGGGAAGGAATGTGG + Intergenic
1143416188 17:6752565-6752587 CTGTGTTTGGGGAAGACTCTAGG - Intergenic
1143924990 17:10361738-10361760 CTGAGTTTGGGGAAGAACGCAGG + Intronic
1143930828 17:10422013-10422035 CTTTGTTAGGGCAAGACATTTGG + Intergenic
1144511601 17:15881834-15881856 CTGTGTTTCTGGAAGACACAAGG - Intergenic
1145123295 17:20279790-20279812 CTGTGGTTTTGGAAGACATGAGG + Intronic
1146956463 17:36938902-36938924 CCGGGTTTGGGGAAGACCCCCGG - Intronic
1151133366 17:71921377-71921399 CTGTGGTTGGTGAAAATATCAGG - Intergenic
1151550403 17:74819439-74819461 CTGTGTTTGCTGAAGAGAGCAGG + Intronic
1152097558 17:78280774-78280796 CTGTGCTTTGGGAAGACATGGGG + Intergenic
1152308404 17:79534708-79534730 CGGTGTCTGGAGAAGAAATCAGG + Intergenic
1155381845 18:25231320-25231342 CTGTGTTGGAGGAGGACAGCTGG + Intronic
1157228525 18:45891000-45891022 ATGTGTTTGGGGAAGACAGGAGG - Intronic
1158883806 18:61806469-61806491 CTGTGTTTGTGGAAGGCCTGAGG + Intergenic
1160313889 18:77822257-77822279 CTGTCTTTTGAGAAGAGATCCGG - Intergenic
1164558962 19:29275461-29275483 CTGTGCTGGGGAAAGACAGCAGG - Intergenic
1165225750 19:34353301-34353323 CTGTGTGTTGGGAAGACATCAGG + Exonic
1166407110 19:42529084-42529106 CTGTCCTTGGGGAAGACTTCAGG + Intronic
1166459124 19:42970585-42970607 CTGTTTTGGGGGAAAACATTGGG - Intronic
1166476072 19:43125852-43125874 CTGTTTTGGGGGAAAACATTGGG - Intronic
1167628554 19:50608443-50608465 CAGTGCTTGCGGAAGAAATCCGG - Intergenic
927461055 2:23298452-23298474 GTGTGTTTTGGAAAGCCATCTGG - Intergenic
927894404 2:26772129-26772151 CTGAGTTTGCGGAAGAAAACAGG - Intronic
929693202 2:44091657-44091679 GTGTGTTTGGGGAAAGTATCTGG + Intergenic
929746068 2:44660193-44660215 CTGTCTTAGTGGAAGACAGCTGG + Intronic
930242863 2:48954327-48954349 CTGTCTTTAGGGAAGAGCTCTGG - Intergenic
930308471 2:49707322-49707344 CTTTATTTGGTGAAGACATGAGG + Intergenic
931461827 2:62456702-62456724 CTGGTCTTGAGGAAGACATCAGG + Intergenic
932215850 2:69965573-69965595 CTGTGTTCTGGGAAGTCGTCAGG - Intergenic
932460452 2:71878850-71878872 CTGTGTGTGGGGAGCACAGCTGG - Intergenic
932720831 2:74138094-74138116 GTGTGTTTTGGGAAGCCCTCAGG - Intronic
934945718 2:98539893-98539915 CTGAGTGTGGGGCACACATCTGG - Intronic
934968383 2:98743026-98743048 CTGTGTTGGTGGGAGACATGTGG + Intergenic
936947814 2:117946332-117946354 CTGGGTTTAGGGAACACACCTGG - Intronic
937508228 2:122561287-122561309 CTGAGTTGGGGGAAGAGATGAGG + Intergenic
939937060 2:148305574-148305596 ATGTGTTTAGCGATGACATCGGG + Intronic
941253334 2:163195632-163195654 CTGTGTTTGTGACAGACAGCAGG + Intergenic
942211295 2:173673524-173673546 CTGTGTTTTGGGGGGACCTCAGG + Intergenic
943670722 2:190657564-190657586 TTGTCTTTTGGGAAGTCATCAGG + Intronic
944602938 2:201321566-201321588 CAGTCTTTCTGGAAGACATCAGG + Intronic
946758198 2:222967318-222967340 CTGTTTTTTGGGAAGTCATCTGG + Intergenic
948425983 2:237886778-237886800 CTGAGTATGGGGATGAAATCAGG + Intronic
948487880 2:238292257-238292279 CTTTGTTTAGGGGAGACATGTGG + Intergenic
1169727267 20:8749137-8749159 CTGTGTTTTAGGAAGCCATCTGG - Intronic
1170038056 20:12010954-12010976 CAGTGTTTGGGGTAGAGATGGGG - Intergenic
1172003907 20:31803928-31803950 CTCTGTTTGGGGCTGACACCTGG - Intergenic
1173020850 20:39267010-39267032 CTGTGTTTGGGGGACCCAGCAGG - Intergenic
1173957049 20:47041377-47041399 CTGCTTCTGGGGAAGAGATCTGG - Intronic
1174576425 20:51541174-51541196 CAGTGTTTGTGGGAAACATCAGG + Intronic
1176953889 21:15077549-15077571 CTGTGTATCTGGAAGACAGCAGG - Intergenic
1178157939 21:29876174-29876196 TTGGGTTTTGGGTAGACATCTGG + Intronic
1178271637 21:31195476-31195498 CTATGTTTGAGGACGACAGCTGG - Intronic
1179106318 21:38403797-38403819 CTGTGCTTGTGGAAGGCAGCTGG - Intronic
1180411743 22:12617976-12617998 CTGTGTTTTGGGAAGGCAATGGG - Intergenic
1182763402 22:32741103-32741125 GTGTTTTGGGGGAAGACATTTGG - Intronic
1184081119 22:42220952-42220974 CAGGGTTTGGGGAAGCCAACAGG - Intronic
1184430335 22:44438561-44438583 CGGTGCTTGGTGAGGACATCAGG + Intergenic
1184804147 22:46781615-46781637 CTGTTTTTGGGGAGGGCATGGGG + Intronic
951080778 3:18447225-18447247 CTGTGTCTGAGAAAGACATCAGG + Intergenic
952213013 3:31248350-31248372 CTGTGTTTGTGGAAGAAGCCTGG + Intergenic
952362342 3:32643374-32643396 GTTTGTTTTGGGAAGAGATCTGG + Intergenic
952653894 3:35760496-35760518 CTTTATTTGGGGAAGATAACAGG + Intronic
952929072 3:38346086-38346108 CTGGGTTTGGGGAGGAATTCTGG + Intergenic
953139586 3:40214878-40214900 CTGAGTTTGGAGACTACATCAGG + Intronic
954279510 3:49566242-49566264 ATTTATTTGGTGAAGACATCAGG + Intronic
956088546 3:65639467-65639489 TTGAGTTTCGGGAAGTCATCTGG + Intronic
956738824 3:72259126-72259148 CTGTGCTTGGGAAACACACCTGG + Intergenic
958680008 3:97317361-97317383 CTGTGGTTGGGTTACACATCAGG - Intronic
958707913 3:97679299-97679321 CTGTGTGTGGGGACGCCCTCTGG - Intronic
960049141 3:113223967-113223989 CTGTGTTTGGGTTCCACATCTGG + Intronic
960733471 3:120751414-120751436 CTGGATTTGGGGAAGGCCTCTGG + Intronic
961530182 3:127535929-127535951 CTGAGTGTGGGGAAGACAGGAGG - Intergenic
961639541 3:128356504-128356526 CTGTCTTTGGAGAAGATGTCAGG + Intronic
962307151 3:134299094-134299116 TTATCTTTGGGGAAGACAGCTGG + Intergenic
963673742 3:148282499-148282521 CTGTTTCTGGGGAAGCCAACTGG + Intergenic
964099492 3:152971736-152971758 CTGTTGTTGATGAAGACATCTGG - Intergenic
965519397 3:169658312-169658334 GTGAGTTTGGGGAAGAGATGGGG - Intronic
965599120 3:170437969-170437991 CTGTTTTTGTGGAAGACACTGGG + Intronic
965687560 3:171320874-171320896 CTGTGTTTAGGCAAGCCAGCAGG - Intronic
967336146 3:188346625-188346647 CTGTGTTTGGGGCAGATGTGAGG + Intronic
967510581 3:190306598-190306620 CTGTGTTTGAGCAAGGCATTTGG - Exonic
967984730 3:195086486-195086508 CTGTGTTTGTTGAATACAACTGG - Intronic
969248435 4:5951805-5951827 CTGGGGTTGGGGAAGAGGTCTGG - Intronic
974980353 4:68948910-68948932 CTGTGTCTGGTGAAGACCTCTGG + Intronic
975601578 4:76105634-76105656 TGGGGTCTGGGGAAGACATCTGG + Intronic
978054610 4:104248661-104248683 CTTTGTTTCTGGAAGACTTCTGG + Intergenic
983766850 4:171494654-171494676 CTGGGTTTACGGAAGCCATCTGG + Intergenic
985438200 4:189954840-189954862 CTGTGCTTTGGGAAGCCAACGGG - Intronic
988654325 5:33191408-33191430 CTGTGTTTAAAGAAGACTTCTGG + Intergenic
990705333 5:58522295-58522317 TTATGTCTGGGGAAGACATCAGG - Intergenic
993023831 5:82623962-82623984 ATGAGTTTGGGGAAAACCTCTGG + Intergenic
995855470 5:116586865-116586887 CAGTGTTTGGGGAAGATTTCAGG - Intergenic
996084694 5:119292507-119292529 CATTTTTTGGGGTAGACATCTGG - Intronic
997135569 5:131321658-131321680 CTGTATTGAGGGAAGACAACTGG + Intronic
999371246 5:151056634-151056656 CTGTGTTGTGGGCAGACTTCGGG - Intronic
999667854 5:153932651-153932673 CTGTCATTGGTGAAGACATTGGG - Intergenic
1000594752 5:163202055-163202077 CTGTGTCTGGTGAGGACCTCAGG - Intergenic
1001414852 5:171538244-171538266 CAGTGTCTGGTGGAGACATCTGG + Intergenic
1002956126 6:1866683-1866705 CTGTGTTTGGTGAAGAGCTCTGG + Intronic
1005376500 6:25187723-25187745 ATGTGTTTGGGGAAAACAAAAGG + Intergenic
1006211921 6:32403101-32403123 AGGTGTATTGGGAAGACATCCGG - Exonic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1007370109 6:41421229-41421251 ATGTGTTTGGGGAAGGCAGGTGG + Intergenic
1009512114 6:64566012-64566034 CTGTGTGTGTGCAAGAAATCTGG + Intronic
1010293425 6:74167147-74167169 CTGTGTGTGGAGAAGACATTTGG + Intergenic
1010794381 6:80102599-80102621 CTGTATTTGGGGAAAGCATATGG - Intergenic
1010823172 6:80440342-80440364 CTGTGCTTAAGGAAGCCATCTGG - Intergenic
1011895791 6:92223316-92223338 CTGTCATTCAGGAAGACATCTGG + Intergenic
1011952851 6:92989259-92989281 CTGTGTGGGGGTAAGACATATGG - Intergenic
1012007777 6:93736043-93736065 CAGTGTTTGGGGAAGTCTCCAGG - Intergenic
1013061643 6:106639779-106639801 CTGTCTTTAGGGAAGACATTGGG - Intronic
1013454059 6:110314081-110314103 CAGGGTTAGGGGCAGACATCTGG - Intronic
1013871144 6:114762180-114762202 TTGTGTTAGGGGAAAACATATGG - Intergenic
1014563838 6:122924270-122924292 ATGTTTTTGAGGAAGAAATCAGG - Intergenic
1014607731 6:123498646-123498668 CTATGATTGGGAAAGACATAAGG + Intronic
1015294410 6:131574387-131574409 CTGTGTTTGGGAGAGACTTTTGG - Intronic
1016511235 6:144845799-144845821 CGGTATTTGGGGGAGAAATCAGG - Intronic
1016634961 6:146277602-146277624 CTGCCTTGGGGGAAGACACCTGG + Intronic
1016974517 6:149794288-149794310 GTGTGTCTGGGGAATACAACTGG - Intronic
1016986887 6:149901691-149901713 CTGTGGATGAGGAAGGCATCAGG - Intergenic
1018798289 6:167203780-167203802 CTGAGTCTGGGGAAGGAATCAGG - Intergenic
1018814423 6:167320396-167320418 CTGAGTCTGGGGAAGGAATCAGG + Intergenic
1021121223 7:16797950-16797972 CTGTGTTTGGGGAAGACATCTGG + Intronic
1021984824 7:26088347-26088369 ATGTTTGTGGGGAAGCCATCAGG - Intergenic
1022980205 7:35597782-35597804 TTGTGTTTGGGGAAAAAAGCAGG + Intergenic
1023364198 7:39446737-39446759 CTGTGTGTGGGATGGACATCCGG + Intronic
1024094474 7:45973047-45973069 CTGCATTTGGGGAAGACAAGTGG + Intergenic
1024903467 7:54349473-54349495 CTGAGTTGTGGGAAGACATGAGG + Intergenic
1025576253 7:62645835-62645857 GTGTGTTTGGGAAAGACTTGAGG - Intergenic
1025616613 7:63123871-63123893 CTGTCTTTGAGTGAGACATCTGG + Intergenic
1028281640 7:88937064-88937086 ATGTGTTTGGGGCAGAAAGCAGG - Intronic
1032795281 7:135271353-135271375 CTGTCTTTGGGGAATAGATCTGG - Intergenic
1033492348 7:141855716-141855738 CTCTGTGTGGGGAAGGCATACGG - Intergenic
1034107699 7:148504566-148504588 CTGGGTTTGGGCAAGTCACCTGG + Intergenic
1037316139 8:17601244-17601266 CTGGGTGTGAGGAAAACATCAGG - Intronic
1037635780 8:20700223-20700245 CTTTGATTGGGGGAGACAGCAGG + Intergenic
1037927148 8:22852435-22852457 ATGGGTTTGGGAAAGAAATCAGG - Intronic
1039570309 8:38581213-38581235 CCGTGTTTGGGGCAGAATTCAGG + Intergenic
1041626031 8:60028073-60028095 CTGGGTTTGGGGAGGACGTAAGG - Intergenic
1042024804 8:64411703-64411725 CTGAGTTTGGGGAAGAAACAGGG - Intergenic
1044752947 8:95433592-95433614 CTCTGTGTTGGGAAAACATCTGG + Intergenic
1055197970 9:73620195-73620217 GGGTGTTTAGGGAAGATATCTGG - Intergenic
1057110970 9:92470928-92470950 TTGTTTTGGGGGAAGACCTCAGG + Intronic
1186214922 X:7289499-7289521 CACTGCTTGGGGAAGACATGTGG - Intronic
1188114293 X:26224296-26224318 GTGCCATTGGGGAAGACATCTGG + Intergenic
1190853866 X:54273784-54273806 CTGGCTTTGGGGAATTCATCTGG + Intronic
1191922520 X:66271542-66271564 CTGTGTGTGGGGAACTCATGGGG - Intergenic
1196586263 X:117432456-117432478 CAGTAACTGGGGAAGACATCAGG - Intergenic
1197390850 X:125862044-125862066 CTATATTTGAGGAAGAAATCCGG + Intergenic
1198790698 X:140342465-140342487 CTGTGGTGGGGGAAGAAAGCAGG + Intergenic
1200289875 X:154861657-154861679 CAGTGGTTGGGGAAAAAATCGGG - Intronic