ID: 1021123147

View in Genome Browser
Species Human (GRCh38)
Location 7:16819717-16819739
Sequence GAGTGGGGAGGGAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7638
Summary {0: 1, 1: 7, 2: 127, 3: 1098, 4: 6405}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021123147 Original CRISPR GAGTGGGGAGGGAGGGAAGA GGG (reversed) Intronic
Too many off-targets to display for this crispr