ID: 1021127989

View in Genome Browser
Species Human (GRCh38)
Location 7:16876268-16876290
Sequence ATATAGCCAGAGATAGAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 550
Summary {0: 1, 1: 0, 2: 4, 3: 46, 4: 499}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021127989 Original CRISPR ATATAGCCAGAGATAGAGAT AGG (reversed) Intronic
900639050 1:3680040-3680062 ATAGAGACAGGGATAGAGACAGG - Intronic
900965410 1:5953882-5953904 ATATAGGAAGAGATGGAGCTAGG - Intronic
901248196 1:7750300-7750322 ATACATCCAGAGATACAGTTAGG + Intronic
902852414 1:19170501-19170523 ATCTTGCAAGAGATAGAGCTGGG - Intronic
903018702 1:20378649-20378671 AGATAGCGAGAGACAGAGAGAGG - Intergenic
903146070 1:21372771-21372793 TTATACCCAGAGAGAGGGATGGG - Intergenic
903305543 1:22410369-22410391 ATATGGACAGAGCTGGAGATTGG + Intergenic
905065527 1:35178126-35178148 AAAAATCCAGAGATAAAGATTGG + Intronic
906332187 1:44895511-44895533 ATATAGAGAGAGAGAGAGAGAGG - Intronic
906421874 1:45675686-45675708 ATATAGCCAGGCATGGTGATAGG - Intronic
907912914 1:58842296-58842318 ATGAAGACAGAGATAGACATTGG - Intergenic
907929553 1:58986708-58986730 ATATAGGCAGAGTTAGGGACTGG + Intergenic
909696323 1:78471786-78471808 ATATAGAGAGAGAGAGAGAGAGG - Intronic
909843984 1:80367216-80367238 ATAAAGCCTGAGATAGACACTGG + Intergenic
910287820 1:85574872-85574894 ATAGAGAGAGAGAGAGAGATGGG - Intronic
911304981 1:96222691-96222713 ATGTAGCCAGGGATGGAGGTAGG - Intergenic
911357333 1:96838434-96838456 AGAGAGACAGAGAGAGAGATCGG - Intergenic
911899977 1:103491106-103491128 ATATATATAGAGAGAGAGATAGG - Intergenic
912474632 1:109927787-109927809 ATAGAGGCAGAGACTGAGATAGG + Intronic
912566941 1:110594276-110594298 ATATAGAGAGAGAGAGAGAGAGG - Intronic
913429047 1:118768755-118768777 AGAAAGCCAGAGATAAAGAAGGG + Intergenic
913465341 1:119135758-119135780 ATAGAGAGAGAGAGAGAGATGGG + Intronic
914465690 1:147926437-147926459 ATATTACCAGCGGTAGAGATGGG + Intergenic
914972329 1:152319117-152319139 ATAAAGTCAGAGATACAGACGGG + Intronic
916306652 1:163342710-163342732 ATATAGAGAGAGACAGAGAAGGG + Intronic
916456622 1:164977495-164977517 ATAGAACCTGAGATAGAGATTGG - Intergenic
916682943 1:167120880-167120902 ATATATACAGAGAGAGAGAGAGG + Intronic
916907088 1:169297601-169297623 ATACAGTTAGAGATAGATATGGG + Intronic
917663897 1:177205287-177205309 ATTTAGCCAGACATAGTGGTGGG - Intronic
918389668 1:184045598-184045620 AAATATCTAGAGATAGACATGGG + Intergenic
920067320 1:203278064-203278086 AGACAGTCAGAGACAGAGATGGG - Intergenic
921322885 1:213960365-213960387 ATATAGCCAGAGATCAGGGTGGG + Intergenic
921696451 1:218215825-218215847 ATAAAGAAAGAAATAGAGATGGG - Intergenic
921756549 1:218863237-218863259 AGATAGGCAGATATAGATATAGG - Intergenic
922090979 1:222394808-222394830 ATAGAGACAGAGATGGAGTTCGG - Intergenic
922719354 1:227892482-227892504 AGAGAGACAGAGAGAGAGATAGG - Intergenic
923069742 1:230551563-230551585 ATATATAGAGAGAGAGAGATGGG - Intergenic
923350332 1:233098794-233098816 ATATGACCAGAGGTAGAGGTGGG - Intronic
923700675 1:236297463-236297485 CTACAGCGAGAGATAAAGATAGG + Intergenic
924255867 1:242182404-242182426 ATAGAGACAGAGATAGAGGTAGG - Intronic
1063597301 10:7447674-7447696 ATATATACAGAGAGAGAGAAAGG + Intergenic
1066498728 10:35969796-35969818 ATGTAGACGGAGATAGAGCTTGG + Intergenic
1066530235 10:36329587-36329609 ATATAGCGAGAGAGAGAGAGAGG + Intergenic
1066991083 10:42514641-42514663 ATATAGCTAGTGATATAGTTTGG + Intergenic
1067823783 10:49554583-49554605 AGATAGGTAGAGATAGAGATAGG + Intergenic
1068071223 10:52198772-52198794 GTAAAGACAGAGATAAAGATTGG - Intronic
1068359515 10:55957966-55957988 ATATAGACAGACAGATAGATAGG - Intergenic
1068489349 10:57702499-57702521 ATATAGACAGAAATATAGATTGG - Intergenic
1068529819 10:58173280-58173302 ATAAAGACAGAGGCAGAGATGGG + Intergenic
1069179476 10:65340065-65340087 ATATAGACAGGAATAGAGAAAGG - Intergenic
1071209407 10:83320632-83320654 TTATAGCTAAAGAGAGAGATAGG + Intergenic
1071738699 10:88331906-88331928 AGATAGCCAGGGAGAGAGAGGGG + Intronic
1073065369 10:100755677-100755699 ATACAGCCAGAGATTTCGATGGG + Intronic
1073350640 10:102817295-102817317 ATATATAGAGAGAGAGAGATAGG + Intergenic
1074198583 10:111210560-111210582 ATATAGAGAGAGAGAGAGACAGG - Intergenic
1074622797 10:115143717-115143739 AGAGAGCCAGAGAGAGAGAGAGG + Intronic
1074716923 10:116228389-116228411 CCATAGCCAGAAATAGAGAGTGG - Intronic
1076151437 10:128165136-128165158 ATAGAGATAGAGCTAGAGATAGG + Intergenic
1076367376 10:129930383-129930405 ATATAGACAGGTATAGATATAGG - Intronic
1076367390 10:129930548-129930570 ATATAGACAGGTATAGATATAGG - Intronic
1076367409 10:129930770-129930792 ATATAGACAGGTATAGATATAGG - Intronic
1076367442 10:129931118-129931140 ATATAGACAGATACAGATATAGG - Intronic
1077801327 11:5541227-5541249 ATTGAGCCAGAGATAGAGGGTGG + Intronic
1078050889 11:7963799-7963821 AGAGAGACAGAGATAGAGTTTGG - Intronic
1079526352 11:21393710-21393732 ATATATCCTGAGATTAAGATTGG + Intronic
1080282594 11:30575634-30575656 TTTTAACCACAGATAGAGATAGG + Intronic
1080373392 11:31678563-31678585 ATCAAGCCAGAGAAAGACATAGG - Intronic
1080765946 11:35296813-35296835 CAATAGCGAGAGATAGTGATGGG - Intronic
1080987727 11:37490072-37490094 AGAGAGCCAGAGAGAGAGACAGG - Intergenic
1082930745 11:58602433-58602455 ATATATCTCGAGAGAGAGATGGG + Intronic
1086190416 11:84072246-84072268 ATATAGCAAGAGACAGGGCTGGG - Intronic
1086998439 11:93386886-93386908 ACAAAGCCAGAGCTAGACATGGG - Intronic
1087206158 11:95397098-95397120 ATATAGAGAGAGAGAGAGAGAGG + Intergenic
1087659219 11:100966344-100966366 ATATATAAAGAGATAGAGATTGG + Intronic
1088598963 11:111459091-111459113 AAATAGCCAGACATAGTGGTGGG + Intergenic
1089382330 11:118044062-118044084 ATTTAGACAGAGATAAATATAGG - Intergenic
1089915969 11:122156676-122156698 AAAGAGCCAGAGACAGAGAAAGG + Intergenic
1090970045 11:131633620-131633642 AGAGAGGCAGAGATAGAGAGAGG - Intronic
1091510698 12:1121482-1121504 ACATAGCCTCAGAAAGAGATAGG + Intronic
1091522295 12:1258152-1258174 ATGTAGCTAGAGATTAAGATAGG - Intronic
1092113051 12:5977862-5977884 ATATATATAGAGAGAGAGATAGG - Intronic
1092992513 12:13916674-13916696 AGAGAGAGAGAGATAGAGATGGG - Intronic
1093291239 12:17324729-17324751 TTATAACCAGAGAGAAAGATCGG + Intergenic
1093345915 12:18038172-18038194 ATCTAGCCTGAGTTAGAGGTAGG - Intergenic
1093824189 12:23662167-23662189 ATATAGAGAGAGAGAGAGAAAGG + Intronic
1094327188 12:29253174-29253196 AGATAGATAGAGAGAGAGATAGG - Intronic
1095249861 12:39966135-39966157 ATATAGAGAGAGAGAGAGGTGGG + Intronic
1095320620 12:40821243-40821265 ATGTATCCAGAGAGACAGATTGG + Intronic
1095856876 12:46869928-46869950 ATGAAGACAGAGATAGAGATTGG - Intergenic
1097449666 12:59721135-59721157 ATATAGCGAGAGAGAGAGACTGG - Intronic
1097551812 12:61081223-61081245 ATATAGAGAGAGAGAGAGAGAGG + Intergenic
1097916291 12:65023664-65023686 ACAAAGACAGAGAGAGAGATAGG - Intergenic
1098027200 12:66216225-66216247 AAATAGCGAGTGTTAGAGATGGG + Intronic
1098140551 12:67446107-67446129 ATTTAGCCAGACAAAGAGATGGG + Intergenic
1098304097 12:69084750-69084772 TTAAAGCCAGAGGCAGAGATTGG + Intergenic
1098772260 12:74567545-74567567 ATAGAGATAGAGATAAAGATAGG - Intergenic
1098779852 12:74672953-74672975 AGATAGACAGAGATAGAGAAGGG - Intergenic
1099099415 12:78419545-78419567 ATAAAGCCAGAAATAGACTTAGG - Intergenic
1099305307 12:80947440-80947462 ATAGAGAGAGAGAGAGAGATTGG + Intronic
1099659885 12:85544192-85544214 ATATATACAGATATACAGATGGG + Intergenic
1100378412 12:94039193-94039215 ATATATACAGAGAGAGAGAGAGG + Intergenic
1101054298 12:100896337-100896359 ATAATCACAGAGATAGAGATTGG + Intronic
1103111594 12:118284630-118284652 AAATAGAAAGAGATGGAGATTGG + Intronic
1103294248 12:119872763-119872785 ATATAGACAGATATGGAGGTAGG - Intronic
1103832480 12:123790826-123790848 ATATAGCCAGAATTATAGGTCGG + Intronic
1104821714 12:131681038-131681060 AGAGAGCCAGAGAAAGAGAGAGG + Intergenic
1104847964 12:131856250-131856272 ATACAGACAGAGACAGAGAGAGG - Intergenic
1105386380 13:19933533-19933555 TTGTTGCCTGAGATAGAGATTGG + Intergenic
1105423639 13:20274725-20274747 ATATAGCCAGAAAGAGATCTGGG + Intergenic
1105644888 13:22306514-22306536 AGATGGCCACAGGTAGAGATTGG - Intergenic
1105647165 13:22333354-22333376 ATAGAGAGAGAGAGAGAGATGGG + Intergenic
1106228118 13:27800270-27800292 ATATAACCATATTTAGAGATAGG + Intergenic
1106270866 13:28152256-28152278 ATATAGCAGGGGATAGAGAGAGG - Intronic
1106768688 13:32941169-32941191 ATATAGGGAGGGAAAGAGATGGG - Intergenic
1106872241 13:34034278-34034300 ATATACACAGAGAAAGAGAGAGG + Intergenic
1108171767 13:47749320-47749342 AGAGAGACAGAGAGAGAGATAGG - Intergenic
1108291485 13:48966218-48966240 TTGTAGCCAGGGAGAGAGATTGG + Intergenic
1108381130 13:49855481-49855503 GTAAAGACAGAGATAGAAATTGG + Intergenic
1108935893 13:55879381-55879403 AAATAGCCAGAGATGGATAAAGG - Intergenic
1110222352 13:73086859-73086881 ATAGAGCCAGAGTGAGTGATGGG + Intergenic
1110452481 13:75652275-75652297 ACATGGCTAGATATAGAGATTGG - Intronic
1110491365 13:76112366-76112388 AGATAGCCAGAGATAAAGACAGG + Intergenic
1110997271 13:82127954-82127976 AACTTGCCAGACATAGAGATGGG - Intergenic
1111201354 13:84941969-84941991 ATATAGACATAGAGAGAGAGGGG - Intergenic
1112093642 13:96108952-96108974 ATAGAGATAGAGATAGAGATAGG - Intronic
1112940760 13:104859061-104859083 ATATAGAGAGAGAGAGAGAAAGG + Intergenic
1113192405 13:107764457-107764479 ATGTAGACAGAGAGAGAGAAAGG + Intronic
1113981429 13:114280459-114280481 ATATAGTCAGGGGGAGAGATGGG - Intergenic
1114374994 14:22135374-22135396 ATATACCCAGAGGTAGGGTTTGG - Intergenic
1115683063 14:35763790-35763812 ATATAGAGAGAGAGAGAGAGAGG + Intronic
1115781081 14:36768954-36768976 ATATAGATATAGATAGATATAGG - Intronic
1116268265 14:42725341-42725363 ATAGAGACAGAGACAGAGATAGG - Intergenic
1116387742 14:44352751-44352773 ATATAGGTAGAGAAAGAGATGGG + Intergenic
1119083622 14:71720235-71720257 ATGTAGCGAGAGAAGGAGATCGG - Intronic
1119635853 14:76272839-76272861 AGAGAGACAGAGAAAGAGATAGG + Intergenic
1119638191 14:76293586-76293608 AGATTGCCAGGCATAGAGATGGG - Intergenic
1120087398 14:80289158-80289180 ATACAGATAAAGATAGAGATAGG + Intronic
1120389843 14:83892059-83892081 GTAGAGACAGAGACAGAGATAGG + Intergenic
1121370291 14:93351688-93351710 ATATGGAGAGAGAGAGAGATTGG + Intronic
1122318732 14:100840782-100840804 ATATAGCCAAAGAGACAGAATGG + Intergenic
1123057250 14:105576767-105576789 ATATAAGGAGAGATAGAGAGAGG - Intergenic
1123784513 15:23656176-23656198 ATATAGAGAGAGAGAGAGTTTGG - Intergenic
1125292793 15:38168093-38168115 ATTTAGCCAGATAAAGAGAGGGG - Intergenic
1125315899 15:38430727-38430749 ATAAAGACAGAGAGAGAGAAAGG - Intergenic
1125398749 15:39277962-39277984 ATATAGACAGTGATATAGTTTGG + Intergenic
1125687503 15:41572337-41572359 GCAGAGCCAGAGCTAGAGATGGG + Intronic
1126341218 15:47642977-47642999 ATACAGACAGAGATGGAAATAGG + Intronic
1130773913 15:86956289-86956311 ATATAGATAGATATAGATATAGG + Intronic
1133924142 16:10180700-10180722 ATATGGACAGAGATGGGGATGGG - Intronic
1134483348 16:14637044-14637066 GTATAGAAAGAGATAGACATAGG - Intronic
1134668843 16:16039649-16039671 AAACAGCCAGAGATAGACTTAGG - Intronic
1135080873 16:19434492-19434514 ATATAGAGAGAGAGAGAGATGGG + Intronic
1135948155 16:26884035-26884057 AGATATCCAGAGATAGGCATAGG + Intergenic
1137221722 16:46459251-46459273 ATATATACAGACATATAGATAGG + Intergenic
1137238549 16:46635291-46635313 TGGTAGCCAGAGATAGAGAGAGG + Intergenic
1138102074 16:54260337-54260359 ATATAGAGAGAGAGAGAGAGAGG + Intronic
1138255687 16:55557234-55557256 AGAGAGACAGAGATAGAGAAAGG - Intronic
1138332698 16:56227752-56227774 ATAAAGCCAGGGAAAGAGGTGGG - Intronic
1139694245 16:68662269-68662291 ATGTGGCTAGAGAGAGAGATTGG + Intronic
1140619730 16:76715959-76715981 ATATAGACAGACACAGACATAGG - Intergenic
1141149260 16:81552820-81552842 ACAAAGCCAGAGAAAGAGAGAGG - Intronic
1141549913 16:84799404-84799426 ATATTTCCAGGGATAAAGATGGG - Intergenic
1141821856 16:86451667-86451689 ATATAGACAGATACAGATATGGG + Intergenic
1141913987 16:87081094-87081116 ATAGAGCCATAGAGAGAGCTAGG - Intergenic
1143328340 17:6116274-6116296 ATATTGCCAGCTATAGAGGTTGG + Intronic
1144145674 17:12395713-12395735 TTAGAGCCAGAGCTAGAGCTTGG - Intergenic
1144169547 17:12646745-12646767 AATTAGCCAGAGAAAGTGATAGG + Intergenic
1144410133 17:14992820-14992842 ATAAAGCCAAAGAAAGAAATGGG - Intergenic
1146512777 17:33464670-33464692 ATATAGAGAGAGAGAGAGAGAGG - Intronic
1147407328 17:40221560-40221582 AAAGAGACAGAGAGAGAGATGGG - Intronic
1147916966 17:43893869-43893891 GTATAGATATAGATAGAGATAGG - Intronic
1148660615 17:49328604-49328626 AGCAAGCAAGAGATAGAGATTGG - Intronic
1149619897 17:58036252-58036274 ATATATAGAGAGAGAGAGATGGG - Intergenic
1149776608 17:59363158-59363180 ATATAGAGAGAGAGAGAGACAGG + Intronic
1150529647 17:65963651-65963673 ATATAGATATAGATATAGATAGG + Intronic
1151045846 17:70918649-70918671 ATTTAAACACAGATAGAGATGGG + Intergenic
1151343155 17:73484763-73484785 ATAAAGGCAGAGGCAGAGATTGG - Intronic
1152272456 17:79332825-79332847 ATAGAGAAAGAGAGAGAGATGGG + Intronic
1153299921 18:3583423-3583445 AAAAAGACAGAGAGAGAGATAGG - Intronic
1154383578 18:13873366-13873388 ATATAAACAGATATAGACATAGG + Intergenic
1154508467 18:15067468-15067490 ATAGAGTCAGAGATGGAGCTGGG + Intergenic
1154944456 18:21148027-21148049 AGATAGATAGAGATAGAGAGAGG - Intergenic
1156608917 18:38703072-38703094 ATATAGTGAGAGATGGGGATTGG - Intergenic
1156883297 18:42105974-42105996 TTATAGCCAGGGAAAGAGATGGG + Intergenic
1157002913 18:43549016-43549038 ATATAGCAAGAGAAAGAAAAGGG + Intergenic
1157106806 18:44781511-44781533 ATATAGAGAGAGACAGAGGTGGG - Intronic
1158741519 18:60147684-60147706 ATATAGACAAATACAGAGATAGG - Intergenic
1159089421 18:63831011-63831033 AAATAGCAAAAGAAAGAGATTGG + Intergenic
1159343646 18:67169620-67169642 ATACAGACAGAGATATAGGTAGG + Intergenic
1159377097 18:67606086-67606108 ATATAGAGAGAGAGAGAGAGAGG - Intergenic
1159396096 18:67858398-67858420 ATGAAGACAGAGACAGAGATTGG + Intergenic
1159444421 18:68523659-68523681 GTACAGCCAGAGGCAGAGATTGG + Intergenic
1160015991 18:75141181-75141203 ATGGAGGCAGAGAGAGAGATTGG + Intergenic
1160019593 18:75170193-75170215 ACAAAGCCAGAGGCAGAGATCGG + Intergenic
1160305360 18:77729089-77729111 GTATAGATAGACATAGAGATAGG - Intergenic
1160328866 18:77974483-77974505 ATATAGACAGACAGAGAGATAGG + Intergenic
1160953421 19:1678730-1678752 AGAGGGCCAGAGACAGAGATAGG - Intergenic
1160957676 19:1701189-1701211 ATAGAGACAGAGAGAGAGAGAGG - Intergenic
1161839738 19:6672324-6672346 ATACACAGAGAGATAGAGATGGG + Intergenic
1162686054 19:12385554-12385576 ATATAGAGAGAGAGAGAGACTGG - Intronic
1162776259 19:12981440-12981462 ACAAAGACAGAGACAGAGATAGG - Intergenic
1164097211 19:22022341-22022363 ACAAAGCCAGAGAGAGCGATAGG + Intergenic
1164610518 19:29628502-29628524 ATATAGACAGAGAGAGGGACAGG + Intergenic
1165204051 19:34168960-34168982 ATCTTGCCTGAAATAGAGATGGG - Intergenic
1166027273 19:40098681-40098703 ATATAGAAAGAGAGAGAGAGGGG + Intergenic
1166183382 19:41123989-41124011 ATACACCCAGAGATGGAGCTTGG - Intronic
1166302116 19:41917247-41917269 ATGCACCCAGAGAGAGAGATGGG - Intronic
1166311967 19:41967895-41967917 ACATAGGGAGAGACAGAGATGGG + Intronic
1167316410 19:48765817-48765839 ATATAGACAGAGAGAGAGACGGG - Intergenic
1167469384 19:49666880-49666902 ATAGAGCCAGATATAAAGAGAGG - Intronic
1167609109 19:50497837-50497859 AGAGAGACAGAGATAGAAATGGG + Intergenic
1167640728 19:50679772-50679794 AGATAGACAGAGACAGAGAGAGG + Intronic
1167680052 19:50913591-50913613 AGAGAGACAGAGACAGAGATGGG - Intergenic
1167680058 19:50913661-50913683 AGAGAGACAGAGACAGAGATGGG - Intergenic
1167680063 19:50913733-50913755 AGAGAGACAGAGACAGAGATGGG - Intergenic
1167680069 19:50913811-50913833 AGAGAGACAGAGACAGAGATGGG - Intergenic
1167680075 19:50913889-50913911 AGAGAGACAGAGACAGAGATGGG - Intergenic
1167680081 19:50913965-50913987 AGAGAGACAGAGACAGAGATGGG - Intergenic
1167680087 19:50914041-50914063 AGAGAGACAGAGACAGAGATGGG - Intergenic
1167680093 19:50914111-50914133 AGAGAGACAGAGACAGAGATGGG - Intergenic
1167680098 19:50914183-50914205 AGAGAGACAGAGACAGAGATGGG - Intergenic
1167680104 19:50914259-50914281 AGAGAGACAGAGACAGAGATGGG - Intergenic
1167680110 19:50914339-50914361 AGAGAGACAGAGACAGAGATGGG - Intergenic
1167680115 19:50914415-50914437 AGAGAGACAGAGACAGAGATGGG - Intergenic
1167680121 19:50914491-50914513 AGAGAGACAGAGACAGAGATGGG - Intergenic
1167680127 19:50914565-50914587 AGAGAGACAGAGACAGAGATGGG - Intergenic
1167740599 19:51322869-51322891 AGATACCCAGAGAAAGAGAGAGG - Intronic
1168327010 19:55543647-55543669 ATATAGACTGAGTTGGAGATGGG - Intronic
1168372700 19:55849552-55849574 ATAGAGTCAGAGGAAGAGATGGG + Intronic
925946091 2:8865265-8865287 ATAGGACCAGAGATATAGATGGG - Intronic
927399388 2:22693632-22693654 AGATAGAGAGAGAGAGAGATAGG + Intergenic
928191941 2:29178752-29178774 ATATATGCAGAGAAAGAGATAGG - Intronic
928486506 2:31737685-31737707 AGAGAGCCAGAGACAGAGGTGGG + Intergenic
929093871 2:38245827-38245849 ATAGAGCTAGAGATAGATAGAGG - Intergenic
929480031 2:42297062-42297084 ATATGGCCAATGATTGAGATAGG - Intronic
930413219 2:51053642-51053664 ACATAGAGAGAGAGAGAGATAGG - Intergenic
930437727 2:51366815-51366837 ATATAGATAGATATAGAGATAGG - Intergenic
931418254 2:62101602-62101624 ATATAGAGAGAGAGAGAGACAGG - Intronic
931867783 2:66431084-66431106 ATCTTTCCAGAGATAGAGAACGG - Intergenic
932687176 2:73881567-73881589 ATATAGAGAGAGAGAGAGAGAGG + Intergenic
933439675 2:82296937-82296959 AGAGAGCCAGAGAGAGAGAAAGG + Intergenic
933600216 2:84321416-84321438 AATAAGTCAGAGATAGAGATGGG + Intergenic
933622165 2:84555574-84555596 ATATAGGTAGAGATATAGATAGG - Intronic
934485198 2:94701280-94701302 ATATACCAAGAAATAGAGCTGGG + Intergenic
935058583 2:99589112-99589134 AAATATGCAGAGATAGACATTGG - Intronic
935109818 2:100082370-100082392 ATAAAGCCAGAGTTAGACTTTGG - Intronic
935554720 2:104496762-104496784 AAATAGACACAGATAGAGAAGGG - Intergenic
936125159 2:109782838-109782860 ATAAAGCCAGAGTTAGACTTTGG + Intergenic
936219534 2:110588630-110588652 ATAAAGCCAGAGTTAGACTTTGG - Intergenic
936478743 2:112865531-112865553 AGACAGACAGAGATAGAGATAGG - Intergenic
937502869 2:122501628-122501650 TTATAGCTAGAAATAGAAATAGG - Intergenic
937801277 2:126083035-126083057 ATATACCCAGAGGCAGTGATGGG - Intergenic
938873468 2:135507337-135507359 CTATAGGGAGAGATAGAGAATGG + Intronic
939158411 2:138554606-138554628 AAGTAGCCAGAGATAGAGATTGG + Intronic
939466156 2:142560576-142560598 ATAAAGACAGAGATAAAGCTGGG + Intergenic
939669830 2:144996880-144996902 CAATAGCAAGGGATAGAGATAGG + Intergenic
939930196 2:148224686-148224708 TTAGAGCTAAAGATAGAGATAGG - Intronic
939930653 2:148229881-148229903 ACAGAGACAGAGACAGAGATGGG - Intronic
940104869 2:150088026-150088048 ATATATATAGAGAGAGAGATAGG - Intergenic
941254055 2:163205715-163205737 CTATAGACAGAGAGAGAGAATGG - Intergenic
941549894 2:166901956-166901978 TTTTAGCCAGAGATAGAGCTGGG + Intronic
942459138 2:176157703-176157725 ACAGAGACAGAGACAGAGATAGG + Intronic
942482574 2:176404891-176404913 AAATAACCAGAAATAGAGGTAGG - Intergenic
942494144 2:176521239-176521261 ATACATCCAGAGGTAGAGAAAGG - Intergenic
942552310 2:177132014-177132036 ATATAGCAATAGATGGAGCTTGG + Intergenic
943117996 2:183697255-183697277 ACATAGGCAGATATAGAGTTAGG - Intergenic
943261682 2:185672661-185672683 ATATAGAGAGAGAGAGAGAGAGG + Intergenic
943749030 2:191492018-191492040 ATATAGAGAGAGAGAGAGAGAGG - Intergenic
945834176 2:214819859-214819881 ATATAGGTAGATATAGATATAGG + Intergenic
946078877 2:217099454-217099476 ACACAGACAGTGATAGAGATAGG - Intergenic
946214226 2:218171423-218171445 ATCTAGCCAGGGACAGAGTTGGG - Intergenic
946582108 2:221140928-221140950 ATAAAGCCAGAGATAGTACTAGG + Intergenic
1168747471 20:256064-256086 ATATATCCATAGATAGAGAGAGG + Intergenic
1169186543 20:3622087-3622109 ATAGAGCAAGATAAAGAGATGGG + Intronic
1169597739 20:7220139-7220161 ATATTGCTAGATATAGAGACTGG + Intergenic
1170760599 20:19246784-19246806 ATAGAGATAGAGATAGAGAAAGG - Intronic
1171127121 20:22612064-22612086 TTATAGACAGAGATTGAGAATGG + Intergenic
1171318124 20:24213863-24213885 ATATAGATATAGATAGAGAATGG + Intergenic
1172454169 20:35053567-35053589 GTATAGCCAATGACAGAGATAGG - Intronic
1172573528 20:35988670-35988692 TTGCAGCCAGAGACAGAGATTGG + Intronic
1173249647 20:41357810-41357832 CTAAAGCCAGAGAAACAGATGGG + Intronic
1173344394 20:42185327-42185349 ATATAGGCAGAGATTCAGATAGG - Intronic
1174089070 20:48032374-48032396 ATAGAGAGAGAGAGAGAGATTGG - Intergenic
1174739177 20:52995413-52995435 ACAGAGCCAGAGAAAGTGATTGG - Intronic
1174911743 20:54615498-54615520 AGAGAGACAGAGATAGAGAAGGG + Intronic
1175637027 20:60593282-60593304 ATATAGACATAGATATAGAAGGG - Intergenic
1177596369 21:23248310-23248332 ATTTAGTCAGAGATACAGTTAGG - Intergenic
1178027082 21:28480080-28480102 ATATAGAGAGAGAGAGAGAGGGG - Intergenic
1178268682 21:31168811-31168833 TAATACCCAGAGATAGAGCTTGG + Intronic
1178430068 21:32511044-32511066 ATATAGATAGAGAGAGAGAGAGG - Intronic
1178779785 21:35590840-35590862 ATATAGAGAGAAATATAGATAGG + Intronic
1178925220 21:36769059-36769081 CTATAGCCAGGGACAGTGATGGG + Intronic
1179069422 21:38057818-38057840 ATAGAGACAGAGATAGAGATGGG - Intronic
1181713065 22:24703582-24703604 AGAGAGACAGAGATAGGGATGGG + Intergenic
1181858747 22:25801855-25801877 ATAGAGCTAAAGCTAGAGATGGG + Intronic
1182725440 22:32441661-32441683 ATATAAAGAGAGATAGAGAACGG + Intronic
1183172726 22:36199678-36199700 CTATACGCAGAAATAGAGATGGG + Intronic
1183180506 22:36256991-36257013 CTATACACAGAAATAGAGATGGG - Intronic
1183472757 22:38018305-38018327 TTATAGACAGAGTCAGAGATAGG + Intronic
949110527 3:255012-255034 TTGTAGCTAGAGATGGAGATAGG - Intronic
949826845 3:8174565-8174587 ATGTAGCCAGAGTTGGAGGTGGG - Intergenic
950298543 3:11853285-11853307 CTATAGCCTAAGAGAGAGATTGG + Intergenic
950383132 3:12634484-12634506 ATATAGCAAGAGAAAGACTTAGG + Intronic
950862042 3:16156929-16156951 ATATATACAGATATAAAGATGGG + Intergenic
951005348 3:17609557-17609579 AGGTAGCCAAAGATAGAGCTTGG - Intronic
951156986 3:19367377-19367399 ATATAGAGAGAGAGAGAGAGTGG - Intronic
951713501 3:25611439-25611461 AAAGAGCTAGAGTTAGAGATTGG - Intronic
953104427 3:39862075-39862097 TTAAAGCCAGAGAGAGAGAAGGG + Intronic
953432410 3:42850938-42850960 TTATGGCCAGAAAAAGAGATTGG + Intronic
955983193 3:64547489-64547511 CTATAGCCAGGGAGAGAGATAGG - Intronic
956041429 3:65149197-65149219 ATATAGAGAGAGAGAGAGATGGG - Intergenic
956057094 3:65311402-65311424 AAAGAGATAGAGATAGAGATGGG + Intergenic
956292343 3:67674345-67674367 AGAGAGACAGAGATAGAGAAGGG - Intergenic
957199199 3:77110693-77110715 ATATAGAGAGAGAGAGAGAGAGG + Intronic
957257347 3:77855619-77855641 GTAGAGATAGAGATAGAGATAGG - Intergenic
957438059 3:80204946-80204968 ATATATAGAGAGAGAGAGATTGG - Intergenic
957505481 3:81115205-81115227 ACAAAGTAAGAGATAGAGATTGG + Intergenic
957566377 3:81889550-81889572 ATAGAGACAGAGAGAGAGAGAGG + Intergenic
957731216 3:84139654-84139676 ATAGATATAGAGATAGAGATAGG + Intergenic
958411771 3:93825844-93825866 ATATACACAGAGAGAGAGAAAGG + Intergenic
958721226 3:97846252-97846274 AAGTAGCCAGAGGTAGGGATGGG - Intronic
960343981 3:116509796-116509818 ATATAGCCACTGATGGAGCTTGG + Intronic
960613075 3:119572448-119572470 ATATAGCAAGAGGTAGAGATGGG - Intergenic
962068074 3:132004202-132004224 ATATAGACATAGATATAGAATGG - Intronic
962687625 3:137862823-137862845 GTATAGCAAGTGATACAGATGGG + Intergenic
962872453 3:139509511-139509533 ATATAGAGAGAGAGAGAGATGGG - Intergenic
963340787 3:144029895-144029917 AGATAGACATAGATAGATATAGG - Intronic
963367495 3:144356016-144356038 ACATAGCCAGAGAGAGACAGAGG + Intergenic
963470027 3:145728771-145728793 ATGTAGCTACATATAGAGATAGG - Intergenic
964167615 3:153727201-153727223 ATATAGCCAGGCATGGTGATGGG + Intergenic
964230394 3:154460175-154460197 ATGAAGGGAGAGATAGAGATTGG - Intergenic
964323020 3:155517541-155517563 ATAAAGACAGAGACAGAAATTGG - Intronic
965306482 3:167070327-167070349 ATATAGAGAGAGAGAGAGAGAGG + Intergenic
965879149 3:173367671-173367693 ATATAGAGAGAGAGAGAGAGAGG + Intergenic
966470472 3:180283296-180283318 TAGAAGCCAGAGATAGAGATGGG - Intergenic
967325965 3:188240020-188240042 AGAGAGCAAGAAATAGAGATGGG + Intronic
967468914 3:189840485-189840507 AGAGAGACAGAGAGAGAGATGGG + Intronic
968357280 3:198119265-198119287 ATATAGAGAGATATAGAAATTGG + Intergenic
969930425 4:10625692-10625714 AGACAGGCAGAGATAGAGAGAGG + Intronic
970657461 4:18247234-18247256 ATATGGGTAGAGGTAGAGATTGG - Intergenic
971046794 4:22813943-22813965 TTACAGGAAGAGATAGAGATTGG - Intergenic
971637336 4:29078209-29078231 AGAGAGACAGAGACAGAGATAGG + Intergenic
971658771 4:29385035-29385057 ATGAAGACAGAGACAGAGATTGG - Intergenic
972581948 4:40402979-40403001 ATAAAGTAAGAGAGAGAGATGGG - Intergenic
972904755 4:43731067-43731089 AAAGAGCTAGAGAAAGAGATAGG + Intergenic
973054430 4:45637472-45637494 ATGTAGACAGAGACAGAGATTGG + Intergenic
973713466 4:53652056-53652078 AGAGAGACAGAGAAAGAGATAGG + Intronic
973847119 4:54924183-54924205 ATGAAGACAGAGACAGAGATTGG - Intergenic
974570039 4:63633711-63633733 ATATAGACAGAGAGATATATAGG - Intergenic
974871908 4:67654274-67654296 AGGCAGCCAGAGAGAGAGATTGG + Intronic
976453862 4:85223250-85223272 ATATATCCAGAGATACAAATAGG + Intergenic
976849769 4:89531479-89531501 ATACATACAGAGGTAGAGATAGG + Intergenic
977184015 4:93914742-93914764 ATATTGACAGAGAGAGAGAATGG - Intergenic
977476821 4:97521391-97521413 ATATAGTTAGAGACAGAGCTAGG + Intronic
977590903 4:98825692-98825714 ATAGAGAGAGAGAGAGAGATCGG + Intergenic
977990804 4:103439414-103439436 ATATACAGACAGATAGAGATAGG - Intergenic
978292556 4:107161036-107161058 ATAATGTCAGAGATAGAGAGGGG + Intronic
979753859 4:124314884-124314906 ATATAGCAAGAGAGAAAGAAAGG + Intergenic
980376246 4:131952728-131952750 ATATACACAGAGAGAGAGAGAGG + Intergenic
980475917 4:133316136-133316158 ATAGAGAGAGAGAAAGAGATGGG + Intergenic
980508527 4:133755763-133755785 ATATACACAGAGAGAGAGAAAGG + Intergenic
980736425 4:136895463-136895485 ATATAGAGAGAGAGAGAGAGAGG - Intergenic
982881940 4:160730972-160730994 ACAGACCCAGAGATAGAGAGGGG + Intergenic
983691738 4:170478618-170478640 ATATAGAGAGAGATATATATAGG + Intergenic
983691739 4:170478645-170478667 ATATAGAGAGAGATATATATAGG + Intergenic
984470820 4:180170984-180171006 ATATTGCCAGAGACAGAAGTTGG + Intergenic
984528014 4:180880523-180880545 ATATGGGCAGAGAGAGTGATAGG - Intergenic
984627955 4:182029461-182029483 ATAGAGCTAAAGAGAGAGATAGG - Intergenic
984665777 4:182427584-182427606 CTATAGCCATAGATAAAGATGGG - Intronic
985669326 5:1198561-1198583 ATAGAGACAAAGAAAGAGATAGG - Intergenic
985767592 5:1788025-1788047 AAAGAGACAGAGACAGAGATAGG - Intergenic
985776338 5:1845193-1845215 ACAGAGATAGAGATAGAGATAGG - Intergenic
985933141 5:3074739-3074761 TTAGAGATAGAGATAGAGATAGG - Intergenic
985960060 5:3294696-3294718 ATAGATACAGAGATAGATATAGG - Intergenic
986636806 5:9830303-9830325 ATATATACAGAAATACAGATAGG + Intergenic
986647599 5:9933141-9933163 AGAGATCCAGAGATAGAGATTGG + Intergenic
987859895 5:23471160-23471182 ACATAGCAAGAGATGGAGAAAGG + Intergenic
987926012 5:24342863-24342885 ATATATCAAGATATAAAGATGGG + Intergenic
988061890 5:26181371-26181393 ATTTAGACAGAGATACAAATCGG - Intergenic
988124517 5:27011847-27011869 ACAGAGGCAGAGAGAGAGATTGG - Intronic
988862463 5:35297859-35297881 ATATAGGCATAGACAGAGCTAGG + Intergenic
989518797 5:42376441-42376463 ATATATACAGAGACAGAGACAGG + Intergenic
990146303 5:52764437-52764459 ATATATACATATATAGAGATAGG + Intergenic
990854181 5:60244764-60244786 ATATGGTGAGAGATAGGGATTGG - Intronic
991129786 5:63109359-63109381 AGGTAGCCAGAGCTAGAGGTAGG + Intergenic
991235440 5:64389449-64389471 ATAAAGCAAGAGAAAGAGATAGG + Intergenic
992537925 5:77730297-77730319 ATGAAGACAGAGATAGAGATTGG + Intronic
993509284 5:88751610-88751632 ATATAGCCACAGGAGGAGATAGG + Intronic
993721594 5:91326357-91326379 AAATAGACAAAGACAGAGATGGG - Intergenic
993783572 5:92100119-92100141 ATATATGTAGAGAGAGAGATAGG - Intergenic
995295782 5:110520047-110520069 ATATAGAGAGAGAGAGAGAGAGG + Intronic
995669071 5:114579753-114579775 ATATAACCAGAGTGACAGATAGG + Intergenic
995720935 5:115132163-115132185 ATAGAGAGAGAGAGAGAGATGGG - Intronic
995948122 5:117675257-117675279 ATAGGGCCAGAATTAGAGATTGG - Intergenic
996022124 5:118602797-118602819 ATATATGCAGAGAGAGAGAGTGG - Intergenic
996105738 5:119500302-119500324 ATATATATAGAGAGAGAGATGGG + Intronic
996847730 5:127919241-127919263 ATATTGTCAGAGATAGTCATGGG - Intergenic
996884609 5:128340818-128340840 ATATAGAGAGAGAGAGAGAGAGG - Intronic
998299012 5:141000336-141000358 AGAGAGACAGAGAGAGAGATAGG - Intronic
998988659 5:147790827-147790849 ATATGGCCAAAGTTAGATATTGG + Intergenic
999155213 5:149453050-149453072 AGATAGACTGAGATTGAGATAGG + Intergenic
999220905 5:149976646-149976668 AAATAGCCAGAAAAAGAGAAAGG - Intronic
1000727043 5:164784561-164784583 ATATAGCCAGAGATTGGGACTGG - Intergenic
1000776002 5:165420967-165420989 AGAGAGACAGAGAGAGAGATAGG - Intergenic
1000956623 5:167551571-167551593 ATATATCCATATAGAGAGATTGG - Intronic
1002868661 6:1146517-1146539 AGATAGGCAGAGACAGAGAGAGG + Intergenic
1003384640 6:5655861-5655883 AAATACTCAGAGACAGAGATGGG - Intronic
1003559743 6:7170723-7170745 ATAAAGCCAGAGTTAGAAATGGG + Intronic
1003783007 6:9450502-9450524 ACATAGTAAGTGATAGAGATAGG - Intergenic
1005291265 6:24381441-24381463 ACAGAGACAGAGACAGAGATTGG + Intergenic
1006002609 6:30977313-30977335 GTCTACCCAGAGATAGAGCTGGG + Intergenic
1006182074 6:32160018-32160040 ATATAGAGAGAGATATATATTGG - Intronic
1006258747 6:32851555-32851577 ATATGGCTAGAGATAGACCTGGG - Intronic
1006576819 6:35052730-35052752 ACATGGCCAGAGAAAGAGATGGG + Intronic
1007824885 6:44592966-44592988 AGAGAGAGAGAGATAGAGATTGG - Intergenic
1008537381 6:52517035-52517057 ATAGAGCCAGTGATGGGGATTGG - Intronic
1009674746 6:66803955-66803977 CTATAACCAAAGTTAGAGATGGG - Intergenic
1009680582 6:66886994-66887016 AAATAGCCAGACATGGTGATGGG - Intergenic
1010634910 6:78246511-78246533 ATATAGAGAGAGAGAGAGAGAGG + Intergenic
1012249788 6:96967467-96967489 ATATATATAGAGAGAGAGATAGG + Intronic
1012443468 6:99284454-99284476 ATCTAGCCACAGAAAGGGATAGG - Intronic
1012601888 6:101109091-101109113 ATATAGACAGAGAAAAATATAGG - Intergenic
1013245547 6:108283864-108283886 AAACAGCCAGAGCTAGAGTTGGG + Intergenic
1013291642 6:108724801-108724823 ATATACCCACACATAGTGATAGG + Intergenic
1014333452 6:120100540-120100562 ATATAGGTATAGATAGATATAGG + Intergenic
1015166641 6:130206700-130206722 TTATGACCAGAGATAAAGATAGG + Intronic
1016188831 6:141234896-141234918 CTATAACTGGAGATAGAGATTGG + Intergenic
1016944571 6:149517551-149517573 ATATATCGAGAGACAGAGAAAGG + Intronic
1018096441 6:160390987-160391009 ATGAAGCCAGAGACAGAGATTGG - Intronic
1018298488 6:162375776-162375798 ATATATCTAGAGAGAGAGAGTGG - Intronic
1018347525 6:162917353-162917375 TTTTAGACAGAGTTAGAGATTGG - Intronic
1019140971 6:169942403-169942425 GTATAAATAGAGATAGAGATAGG + Intergenic
1020478163 7:8623875-8623897 ACATATACAGAGATAGGGATGGG - Intronic
1020578048 7:9959005-9959027 ATATAGCAAGAGAAATAGATGGG - Intergenic
1021127989 7:16876268-16876290 ATATAGCCAGAGATAGAGATAGG - Intronic
1021538327 7:21729302-21729324 AAGAAGCCAGGGATAGAGATGGG - Intronic
1021560890 7:21967772-21967794 AGAGAGACAGAGACAGAGATAGG - Intergenic
1022048448 7:26642849-26642871 ATATAGCTAGGTATAGACATAGG + Intronic
1023593354 7:41802138-41802160 AGAGAGCCAGAGAGAGAGAGAGG - Intergenic
1023683589 7:42713507-42713529 ATAAAGACAGAAGTAGAGATAGG - Intergenic
1024081171 7:45856836-45856858 ATATAGAGAGAGAGAGAGAGAGG + Intergenic
1024130511 7:46347909-46347931 ATATGGAAAGAGATAGAGACAGG + Intergenic
1024590747 7:50880405-50880427 AGATAGATAGAGATATAGATAGG + Intergenic
1024711589 7:52021013-52021035 ATAGAGACAGAGACAGAGAGAGG + Intergenic
1026508186 7:71004623-71004645 ATACAGACAGAGAGAGAGAGAGG + Intergenic
1027364409 7:77442538-77442560 ATATAGACAGTGCTAGACATGGG + Intergenic
1027621171 7:80487332-80487354 CTGTAGCCAGAGAGATAGATTGG + Intronic
1027624113 7:80527150-80527172 ATTTAGCCAGGCATAGAGGTGGG + Intronic
1028563026 7:92196420-92196442 ATAGAGACACAGAGAGAGATAGG - Intergenic
1028835737 7:95373128-95373150 ATATATCCAGTGATAGATAGGGG - Intronic
1030346874 7:108443974-108443996 AGATAGAGAGAGAGAGAGATAGG + Intronic
1030419362 7:109288111-109288133 AAAAAGACAGAGATAGAAATTGG - Intergenic
1030789983 7:113712656-113712678 ATATAGCTAGATATAGATAGAGG + Intergenic
1030939350 7:115627177-115627199 ATACTGCAAGAGATAGACATTGG + Intergenic
1030943573 7:115686975-115686997 AGATAGATAGAAATAGAGATAGG - Intergenic
1031321397 7:120334010-120334032 ATAAAGGCAGAAATAGAAATTGG + Intronic
1031326674 7:120408399-120408421 TTATAGCTAGAGGTAAAGATTGG + Intronic
1033478073 7:141710086-141710108 AAAAACCCAGAGATAGACATCGG - Intronic
1034067995 7:148155189-148155211 ATTTAGGAAGAGACAGAGATGGG + Intronic
1034107562 7:148503275-148503297 ATATAGCCAGAGCCTGTGATGGG - Intergenic
1034415080 7:150959960-150959982 ATATAGGCAGAGAGAGGGGTAGG - Intronic
1034628240 7:152510624-152510646 AAATAAACAGAAATAGAGATGGG + Intergenic
1035032963 7:155874457-155874479 AAATAGAGAGAGATAGAGATGGG + Intergenic
1035777228 8:2197418-2197440 AGATAGCTATAGATACAGATAGG - Intergenic
1035777233 8:2197563-2197585 ATATAGATATAGATACAGATAGG - Intergenic
1035777238 8:2197695-2197717 ATATAGATACAGATACAGATAGG - Intergenic
1036686153 8:10912832-10912854 ATATAGAGAGAGAAAGAGATAGG + Intronic
1037657575 8:20898649-20898671 ATATACACAGAGAGAGAGAGAGG + Intergenic
1038262178 8:26005558-26005580 ATATAGAGAGAGAGAGAGAGAGG + Intronic
1040365807 8:46713885-46713907 ATATAATCAGAGAGAGAGAGGGG - Intergenic
1041603960 8:59758141-59758163 ATTCAGGCAGAGATTGAGATTGG - Intergenic
1041639107 8:60177718-60177740 ATATACACAGACATAAAGATGGG - Intergenic
1041688997 8:60671185-60671207 AGAGAGACAGAGATAGAGATAGG + Intergenic
1042369596 8:67976418-67976440 AGAGAGACAGAGAGAGAGATGGG + Intronic
1042369605 8:67976569-67976591 ACAGAGACAGAGAGAGAGATGGG + Intronic
1042486197 8:69348419-69348441 ATATAGACAGAAAAAAAGATAGG + Intergenic
1042841221 8:73125674-73125696 AGACAGACAGAGATAGAGACAGG - Intergenic
1043093879 8:75940004-75940026 ATAAAGAGAGAGAAAGAGATGGG - Intergenic
1043206612 8:77451651-77451673 AGATAGAAAGAGATAGAGAACGG + Intergenic
1043257603 8:78156084-78156106 ATATAGAGAGAGAGAGAGAGAGG + Intergenic
1043786470 8:84407001-84407023 ATATAGAGAGAGAGAGAGAGAGG - Intronic
1044362318 8:91301689-91301711 ATAAAAGCAGAGATAGAAATAGG - Intronic
1044585345 8:93864386-93864408 AAAAAGATAGAGATAGAGATGGG + Intronic
1044708445 8:95031333-95031355 ATATAGACAGATATACAGAAAGG - Intronic
1045398008 8:101781192-101781214 ATATACCCTGAGAGAGAGAATGG + Intronic
1045734907 8:105283767-105283789 ATAGAGATAGAGATAGAGATAGG + Intronic
1046060528 8:109134275-109134297 ACATAGCCTGAGTCAGAGATAGG + Intergenic
1047598993 8:126407744-126407766 AGAGAGACAGAGAGAGAGATTGG + Intergenic
1048162301 8:132032483-132032505 ATAGAGACAGAGAAAGAGAGGGG - Intronic
1048213745 8:132478501-132478523 ATATTGCTAGAGACAGAGAGAGG + Intronic
1049356403 8:142191062-142191084 GGAGAGCCAGAGACAGAGATAGG - Intergenic
1050337128 9:4600486-4600508 AGAGAGCCAGAGAGAGAGAGAGG + Intronic
1050748655 9:8909801-8909823 ATAGAGACAGAGATAGAGATAGG + Intronic
1052660122 9:31418979-31419001 ATATTGCTAGTGATAGAGACAGG + Intergenic
1053005370 9:34600692-34600714 ACATAGATAGAGACAGAGATAGG - Intergenic
1053155731 9:35777489-35777511 ATATATATAGAGAGAGAGATAGG + Intergenic
1054737317 9:68768402-68768424 ATGTAGCCAGAGACAGAAGTTGG + Intronic
1055657665 9:78468204-78468226 ATAAAGCAAGATAAAGAGATAGG - Intergenic
1055882708 9:81020780-81020802 ATACAGTCAGAAATAGAGAAGGG + Intergenic
1056147686 9:83750049-83750071 CTTGAGCCAGAGATAGAGTTTGG - Intronic
1056687842 9:88781385-88781407 ATTTAGCAAGAGATACAGAATGG + Intergenic
1057240836 9:93407143-93407165 ATATAGATATAGATAGATATAGG + Intergenic
1057693263 9:97306053-97306075 AAAAAGCCAGAGATAGGGAACGG - Intergenic
1058403952 9:104650369-104650391 ATATACACAGAGATGGAGAATGG + Intergenic
1058570118 9:106332651-106332673 ATATGGATAGAGAAAGAGATGGG + Intergenic
1059351938 9:113671725-113671747 AATTAGCCAGAGAGAGAGAAAGG - Intergenic
1059412987 9:114145300-114145322 ATAGAGCCAGAGATGGAAACTGG + Intergenic
1059901604 9:118933670-118933692 AGAAAGACAGAGATAGAGAGGGG + Intergenic
1060607714 9:124932063-124932085 ATATAGAAAGGGAGAGAGATTGG + Intronic
1060954397 9:127628182-127628204 ATAAAGTGACAGATAGAGATGGG - Intronic
1062540152 9:137038258-137038280 ATATAGAGAGAGAGAGAGAGGGG - Intergenic
1185681797 X:1894420-1894442 AGAGAGACAGAGATAGAGACAGG - Intergenic
1186140132 X:6563201-6563223 ATATAAACAGATGTAGAGATAGG + Intergenic
1186206214 X:7203788-7203810 ATATAGAGAGAGAGAGAGACAGG + Intergenic
1186903281 X:14082096-14082118 ATATATACAGAGAAAGACATAGG - Intergenic
1187135605 X:16544334-16544356 AGATAGACAGAGAGAGAGATGGG + Intergenic
1187676831 X:21724486-21724508 ATATATCTATAGATAGAGGTGGG + Intronic
1187715274 X:22096356-22096378 ATAGAGCCAGGGCTAGAGAGAGG + Intronic
1187973244 X:24679446-24679468 ATAATGCTAAAGATAGAGATAGG + Intergenic
1188150036 X:26661979-26662001 ATATTACCAGAGATAAAGAAGGG + Intergenic
1188460029 X:30414680-30414702 ATAAACCCAGAGGTAGAGAATGG + Intergenic
1190530802 X:51373970-51373992 ATATGGAGAGAGAGAGAGATAGG - Intergenic
1190937690 X:55011252-55011274 ATATAAACAAATATAGAGATTGG - Intronic
1190972365 X:55363110-55363132 AAAGAGACAGAGAGAGAGATTGG - Intergenic
1190996975 X:55619210-55619232 ATATAGCGAGACAGAGAGGTGGG - Intergenic
1191997589 X:67113053-67113075 CTATACCCAAGGATAGAGATGGG + Intergenic
1192461036 X:71317736-71317758 ATATAGAGAGAGAGAGAGAATGG - Intergenic
1193185306 X:78504852-78504874 TTATAGCTAAAGAGAGAGATAGG + Intergenic
1193305996 X:79952494-79952516 TTATAGCCAAAGAGAGAGACAGG + Intergenic
1193710598 X:84875081-84875103 ATATAGAGAGAGAGAGAGAATGG + Intergenic
1194322868 X:92474082-92474104 ATTGAGCCACAGATAGAGATAGG - Intronic
1194550555 X:95292726-95292748 AAATAGGTAGAGAAAGAGATAGG + Intergenic
1194833445 X:98654625-98654647 ATATAGAGAGAGAGAGAGAGAGG + Intergenic
1195514962 X:105763630-105763652 ATAAAGACAGAGGTAGAGAGGGG + Intronic
1195847128 X:109240888-109240910 AGAGAGGCAGAGAGAGAGATAGG - Intergenic
1195847130 X:109240912-109240934 AGAGAGGCAGAGAGAGAGATAGG - Intergenic
1195900498 X:109792559-109792581 GTAAAGCTAGACATAGAGATTGG - Intergenic
1196034318 X:111127054-111127076 ATATAGCCATAGAAAAAGACTGG - Intronic
1196652220 X:118179587-118179609 ATATAGAAAGAGATGGAGCTGGG + Intergenic
1196904917 X:120421573-120421595 ATATAGAGAGATAGAGAGATAGG + Intergenic
1197592961 X:128431193-128431215 AAACAGCCAGAGATAGACTTGGG + Intergenic
1198653800 X:138891971-138891993 ATAGAGAGAGAGACAGAGATTGG - Intronic
1199494025 X:148433103-148433125 ATCTGGCCAGAGATGGAGAGTGG - Intergenic
1200171678 X:154080784-154080806 AAATAACCAGATCTAGAGATGGG + Intronic
1200376022 X:155781110-155781132 ATAGAGAGAGAGAGAGAGATGGG + Exonic
1200631021 Y:5587561-5587583 ATTGAGCCACAGATAGAGATAGG - Intronic
1201396487 Y:13554453-13554475 ATGAAGCCAGAGATAGTGTTAGG + Intergenic
1201705879 Y:16936525-16936547 AGAGAGACAGAGAGAGAGATGGG + Intergenic
1201714231 Y:17026452-17026474 ATATAGAGAGAGAGAGAGAGAGG - Intergenic
1202628099 Y:56881190-56881212 ATATATACAGAGAGAGAGAGAGG + Intergenic