ID: 1021131140

View in Genome Browser
Species Human (GRCh38)
Location 7:16913976-16913998
Sequence CAGTAGCAGCAGCAGCAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021131140_1021131147 10 Left 1021131140 7:16913976-16913998 CCACACTGCTGCTGCTGCTACTG No data
Right 1021131147 7:16914009-16914031 AGGGGTCACGTCTGAGATTCAGG No data
1021131140_1021131146 -8 Left 1021131140 7:16913976-16913998 CCACACTGCTGCTGCTGCTACTG No data
Right 1021131146 7:16913991-16914013 TGCTACTGAGGGAGAGGAAGGGG No data
1021131140_1021131144 -10 Left 1021131140 7:16913976-16913998 CCACACTGCTGCTGCTGCTACTG No data
Right 1021131144 7:16913989-16914011 GCTGCTACTGAGGGAGAGGAAGG No data
1021131140_1021131145 -9 Left 1021131140 7:16913976-16913998 CCACACTGCTGCTGCTGCTACTG No data
Right 1021131145 7:16913990-16914012 CTGCTACTGAGGGAGAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021131140 Original CRISPR CAGTAGCAGCAGCAGCAGTG TGG (reversed) Intergenic
No off target data available for this crispr