ID: 1021131783

View in Genome Browser
Species Human (GRCh38)
Location 7:16920749-16920771
Sequence GTCTTGCACTGAAAAGTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021131780_1021131783 14 Left 1021131780 7:16920712-16920734 CCTGTTCTTTTCCTTATAGTTTT No data
Right 1021131783 7:16920749-16920771 GTCTTGCACTGAAAAGTCTCTGG No data
1021131781_1021131783 3 Left 1021131781 7:16920723-16920745 CCTTATAGTTTTATTGCCTTGTC No data
Right 1021131783 7:16920749-16920771 GTCTTGCACTGAAAAGTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021131783 Original CRISPR GTCTTGCACTGAAAAGTCTC TGG Intergenic
No off target data available for this crispr