ID: 1021133152

View in Genome Browser
Species Human (GRCh38)
Location 7:16935102-16935124
Sequence GAGGCCTACTTTTAATTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021133146_1021133152 21 Left 1021133146 7:16935058-16935080 CCAGTTGTCACCAAGGGGGAACA No data
Right 1021133152 7:16935102-16935124 GAGGCCTACTTTTAATTGCTTGG No data
1021133147_1021133152 11 Left 1021133147 7:16935068-16935090 CCAAGGGGGAACACGTTAAAATG No data
Right 1021133152 7:16935102-16935124 GAGGCCTACTTTTAATTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021133152 Original CRISPR GAGGCCTACTTTTAATTGCT TGG Intergenic
No off target data available for this crispr