ID: 1021134777

View in Genome Browser
Species Human (GRCh38)
Location 7:16952165-16952187
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021134777_1021134784 0 Left 1021134777 7:16952165-16952187 CCCCCACACCTTTCTTGCTCCCA No data
Right 1021134784 7:16952188-16952210 GAGACAGCCCAGACAGCTTATGG No data
1021134777_1021134787 25 Left 1021134777 7:16952165-16952187 CCCCCACACCTTTCTTGCTCCCA No data
Right 1021134787 7:16952213-16952235 AGCTCAGCAGAAAGCACAGCTGG No data
1021134777_1021134788 29 Left 1021134777 7:16952165-16952187 CCCCCACACCTTTCTTGCTCCCA No data
Right 1021134788 7:16952217-16952239 CAGCAGAAAGCACAGCTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021134777 Original CRISPR TGGGAGCAAGAAAGGTGTGG GGG (reversed) Intergenic
No off target data available for this crispr