ID: 1021134780

View in Genome Browser
Species Human (GRCh38)
Location 7:16952168-16952190
Sequence CTCTGGGAGCAAGAAAGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021134780_1021134787 22 Left 1021134780 7:16952168-16952190 CCACACCTTTCTTGCTCCCAGAG No data
Right 1021134787 7:16952213-16952235 AGCTCAGCAGAAAGCACAGCTGG No data
1021134780_1021134784 -3 Left 1021134780 7:16952168-16952190 CCACACCTTTCTTGCTCCCAGAG No data
Right 1021134784 7:16952188-16952210 GAGACAGCCCAGACAGCTTATGG No data
1021134780_1021134788 26 Left 1021134780 7:16952168-16952190 CCACACCTTTCTTGCTCCCAGAG No data
Right 1021134788 7:16952217-16952239 CAGCAGAAAGCACAGCTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021134780 Original CRISPR CTCTGGGAGCAAGAAAGGTG TGG (reversed) Intergenic