ID: 1021134782

View in Genome Browser
Species Human (GRCh38)
Location 7:16952184-16952206
Sequence AAGCTGTCTGGGCTGTCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021134782_1021134788 10 Left 1021134782 7:16952184-16952206 CCCAGAGACAGCCCAGACAGCTT No data
Right 1021134788 7:16952217-16952239 CAGCAGAAAGCACAGCTGGATGG No data
1021134782_1021134787 6 Left 1021134782 7:16952184-16952206 CCCAGAGACAGCCCAGACAGCTT No data
Right 1021134787 7:16952213-16952235 AGCTCAGCAGAAAGCACAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021134782 Original CRISPR AAGCTGTCTGGGCTGTCTCT GGG (reversed) Intergenic
No off target data available for this crispr