ID: 1021134784

View in Genome Browser
Species Human (GRCh38)
Location 7:16952188-16952210
Sequence GAGACAGCCCAGACAGCTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021134779_1021134784 -2 Left 1021134779 7:16952167-16952189 CCCACACCTTTCTTGCTCCCAGA No data
Right 1021134784 7:16952188-16952210 GAGACAGCCCAGACAGCTTATGG No data
1021134780_1021134784 -3 Left 1021134780 7:16952168-16952190 CCACACCTTTCTTGCTCCCAGAG No data
Right 1021134784 7:16952188-16952210 GAGACAGCCCAGACAGCTTATGG No data
1021134778_1021134784 -1 Left 1021134778 7:16952166-16952188 CCCCACACCTTTCTTGCTCCCAG No data
Right 1021134784 7:16952188-16952210 GAGACAGCCCAGACAGCTTATGG No data
1021134777_1021134784 0 Left 1021134777 7:16952165-16952187 CCCCCACACCTTTCTTGCTCCCA No data
Right 1021134784 7:16952188-16952210 GAGACAGCCCAGACAGCTTATGG No data
1021134781_1021134784 -8 Left 1021134781 7:16952173-16952195 CCTTTCTTGCTCCCAGAGACAGC No data
Right 1021134784 7:16952188-16952210 GAGACAGCCCAGACAGCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021134784 Original CRISPR GAGACAGCCCAGACAGCTTA TGG Intergenic