ID: 1021134786

View in Genome Browser
Species Human (GRCh38)
Location 7:16952196-16952218
Sequence TGAGCTTTCCATAAGCTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021134786_1021134790 30 Left 1021134786 7:16952196-16952218 CCAGACAGCTTATGGAAAGCTCA No data
Right 1021134790 7:16952249-16952271 CACTACTGTTCAAAGCCTGAGGG No data
1021134786_1021134789 29 Left 1021134786 7:16952196-16952218 CCAGACAGCTTATGGAAAGCTCA No data
Right 1021134789 7:16952248-16952270 ACACTACTGTTCAAAGCCTGAGG No data
1021134786_1021134787 -6 Left 1021134786 7:16952196-16952218 CCAGACAGCTTATGGAAAGCTCA No data
Right 1021134787 7:16952213-16952235 AGCTCAGCAGAAAGCACAGCTGG No data
1021134786_1021134788 -2 Left 1021134786 7:16952196-16952218 CCAGACAGCTTATGGAAAGCTCA No data
Right 1021134788 7:16952217-16952239 CAGCAGAAAGCACAGCTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021134786 Original CRISPR TGAGCTTTCCATAAGCTGTC TGG (reversed) Intergenic