ID: 1021134787

View in Genome Browser
Species Human (GRCh38)
Location 7:16952213-16952235
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021134779_1021134787 23 Left 1021134779 7:16952167-16952189 CCCACACCTTTCTTGCTCCCAGA No data
Right 1021134787 7:16952213-16952235 AGCTCAGCAGAAAGCACAGCTGG No data
1021134780_1021134787 22 Left 1021134780 7:16952168-16952190 CCACACCTTTCTTGCTCCCAGAG No data
Right 1021134787 7:16952213-16952235 AGCTCAGCAGAAAGCACAGCTGG No data
1021134783_1021134787 5 Left 1021134783 7:16952185-16952207 CCAGAGACAGCCCAGACAGCTTA No data
Right 1021134787 7:16952213-16952235 AGCTCAGCAGAAAGCACAGCTGG No data
1021134781_1021134787 17 Left 1021134781 7:16952173-16952195 CCTTTCTTGCTCCCAGAGACAGC No data
Right 1021134787 7:16952213-16952235 AGCTCAGCAGAAAGCACAGCTGG No data
1021134777_1021134787 25 Left 1021134777 7:16952165-16952187 CCCCCACACCTTTCTTGCTCCCA No data
Right 1021134787 7:16952213-16952235 AGCTCAGCAGAAAGCACAGCTGG No data
1021134782_1021134787 6 Left 1021134782 7:16952184-16952206 CCCAGAGACAGCCCAGACAGCTT No data
Right 1021134787 7:16952213-16952235 AGCTCAGCAGAAAGCACAGCTGG No data
1021134778_1021134787 24 Left 1021134778 7:16952166-16952188 CCCCACACCTTTCTTGCTCCCAG No data
Right 1021134787 7:16952213-16952235 AGCTCAGCAGAAAGCACAGCTGG No data
1021134785_1021134787 -5 Left 1021134785 7:16952195-16952217 CCCAGACAGCTTATGGAAAGCTC No data
Right 1021134787 7:16952213-16952235 AGCTCAGCAGAAAGCACAGCTGG No data
1021134786_1021134787 -6 Left 1021134786 7:16952196-16952218 CCAGACAGCTTATGGAAAGCTCA No data
Right 1021134787 7:16952213-16952235 AGCTCAGCAGAAAGCACAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021134787 Original CRISPR AGCTCAGCAGAAAGCACAGC TGG Intergenic