ID: 1021134789

View in Genome Browser
Species Human (GRCh38)
Location 7:16952248-16952270
Sequence ACACTACTGTTCAAAGCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021134785_1021134789 30 Left 1021134785 7:16952195-16952217 CCCAGACAGCTTATGGAAAGCTC No data
Right 1021134789 7:16952248-16952270 ACACTACTGTTCAAAGCCTGAGG No data
1021134786_1021134789 29 Left 1021134786 7:16952196-16952218 CCAGACAGCTTATGGAAAGCTCA No data
Right 1021134789 7:16952248-16952270 ACACTACTGTTCAAAGCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021134789 Original CRISPR ACACTACTGTTCAAAGCCTG AGG Intergenic
No off target data available for this crispr