ID: 1021136805

View in Genome Browser
Species Human (GRCh38)
Location 7:16974843-16974865
Sequence CATGGGAGGGACACCGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021136805_1021136813 26 Left 1021136805 7:16974843-16974865 CCTCCCACGGTGTCCCTCCCATG No data
Right 1021136813 7:16974892-16974914 TTCAAGATGAGATTTGAGTGTGG 0: 515
1: 8500
2: 11760
3: 9478
4: 6756
1021136805_1021136811 -6 Left 1021136805 7:16974843-16974865 CCTCCCACGGTGTCCCTCCCATG No data
Right 1021136811 7:16974860-16974882 CCCATGACATGTGAGAATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021136805 Original CRISPR CATGGGAGGGACACCGTGGG AGG (reversed) Intergenic
No off target data available for this crispr