ID: 1021136811

View in Genome Browser
Species Human (GRCh38)
Location 7:16974860-16974882
Sequence CCCATGACATGTGAGAATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021136807_1021136811 -10 Left 1021136807 7:16974847-16974869 CCACGGTGTCCCTCCCATGACAT No data
Right 1021136811 7:16974860-16974882 CCCATGACATGTGAGAATTATGG No data
1021136802_1021136811 14 Left 1021136802 7:16974823-16974845 CCGCTCCTGTGATTCAATTACCT No data
Right 1021136811 7:16974860-16974882 CCCATGACATGTGAGAATTATGG No data
1021136805_1021136811 -6 Left 1021136805 7:16974843-16974865 CCTCCCACGGTGTCCCTCCCATG No data
Right 1021136811 7:16974860-16974882 CCCATGACATGTGAGAATTATGG No data
1021136806_1021136811 -9 Left 1021136806 7:16974846-16974868 CCCACGGTGTCCCTCCCATGACA No data
Right 1021136811 7:16974860-16974882 CCCATGACATGTGAGAATTATGG No data
1021136803_1021136811 9 Left 1021136803 7:16974828-16974850 CCTGTGATTCAATTACCTCCCAC 0: 230
1: 3458
2: 6663
3: 9466
4: 10303
Right 1021136811 7:16974860-16974882 CCCATGACATGTGAGAATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021136811 Original CRISPR CCCATGACATGTGAGAATTA TGG Intergenic
No off target data available for this crispr